Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640284_at:

>probe:Drosophila_2:1640284_at:189:369; Interrogation_Position=3501; Antisense; GAAGGCAAATGATGCCCCACGGCGC
>probe:Drosophila_2:1640284_at:424:301; Interrogation_Position=3516; Antisense; CCCACGGCGCAGGACGATTTAGAAT
>probe:Drosophila_2:1640284_at:620:305; Interrogation_Position=3560; Antisense; CCTATGTGTGTTTGTTTGTCTGTTC
>probe:Drosophila_2:1640284_at:648:727; Interrogation_Position=3575; Antisense; TTGTCTGTTCGAGCCGTTAGCAAAA
>probe:Drosophila_2:1640284_at:215:99; Interrogation_Position=3605; Antisense; AGATGTTTCGATGGCGATCCACCAA
>probe:Drosophila_2:1640284_at:675:575; Interrogation_Position=3617; Antisense; GGCGATCCACCAAAGCTGTCAATAA
>probe:Drosophila_2:1640284_at:172:279; Interrogation_Position=3742; Antisense; CTAGTTGCTGTGTTCATTGTTGCTA
>probe:Drosophila_2:1640284_at:72:473; Interrogation_Position=3801; Antisense; GTTAACCGAACTATCACTACGTACT
>probe:Drosophila_2:1640284_at:407:489; Interrogation_Position=3821; Antisense; GTACTATCCAACTAACTATCTATCT
>probe:Drosophila_2:1640284_at:242:275; Interrogation_Position=3844; Antisense; CTTACCTGTATTATTCGATCTGTGT
>probe:Drosophila_2:1640284_at:440:515; Interrogation_Position=3865; Antisense; GTGTATCAATCATTACGTTACCATA
>probe:Drosophila_2:1640284_at:548:475; Interrogation_Position=3881; Antisense; GTTACCATACTGTTCTGTACTGTCG
>probe:Drosophila_2:1640284_at:222:217; Interrogation_Position=3908; Antisense; AAGTTTGACTCGTTTCCATATGGCC
>probe:Drosophila_2:1640284_at:262:719; Interrogation_Position=3921; Antisense; TTCCATATGGCCAAGAGCCGCAATT

Paste this into a BLAST search page for me
GAAGGCAAATGATGCCCCACGGCGCCCCACGGCGCAGGACGATTTAGAATCCTATGTGTGTTTGTTTGTCTGTTCTTGTCTGTTCGAGCCGTTAGCAAAAAGATGTTTCGATGGCGATCCACCAAGGCGATCCACCAAAGCTGTCAATAACTAGTTGCTGTGTTCATTGTTGCTAGTTAACCGAACTATCACTACGTACTGTACTATCCAACTAACTATCTATCTCTTACCTGTATTATTCGATCTGTGTGTGTATCAATCATTACGTTACCATAGTTACCATACTGTTCTGTACTGTCGAAGTTTGACTCGTTTCCATATGGCCTTCCATATGGCCAAGAGCCGCAATT

Full Affymetrix probeset data:

Annotations for 1640284_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime