FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640285_at:

>probe:Drosophila_2:1640285_at:486:203; Interrogation_Position=221; Antisense; AAGCCGGACCAGATGGTGCGCCCGC
>probe:Drosophila_2:1640285_at:261:625; Interrogation_Position=237; Antisense; TGCGCCCGCTGCACCCGGAGAGGAA
>probe:Drosophila_2:1640285_at:260:315; Interrogation_Position=324; Antisense; GCCATTCGAGTACTCGATCGATCTG
>probe:Drosophila_2:1640285_at:184:81; Interrogation_Position=356; Antisense; AGGGTGCCGAGGTGCCCTATGTCAA
>probe:Drosophila_2:1640285_at:728:79; Interrogation_Position=365; Antisense; AGGTGCCCTATGTCAAGAACTACGA
>probe:Drosophila_2:1640285_at:190:61; Interrogation_Position=374; Antisense; ATGTCAAGAACTACGAGCCACCACC
>probe:Drosophila_2:1640285_at:648:415; Interrogation_Position=415; Antisense; GAGCCAGTGCCAGCCGCTGAAGGAG
>probe:Drosophila_2:1640285_at:578:607; Interrogation_Position=477; Antisense; TGAGGGTGCTGCTCCACCCGCAGAA
>probe:Drosophila_2:1640285_at:487:263; Interrogation_Position=497; Antisense; CAGAAGGCGCTGTTCCTCCAGCTGA
>probe:Drosophila_2:1640285_at:23:603; Interrogation_Position=507; Antisense; TGTTCCTCCAGCTGACGGTGCTGCT
>probe:Drosophila_2:1640285_at:556:611; Interrogation_Position=519; Antisense; TGACGGTGCTGCTCCGCCAGCTGAG
>probe:Drosophila_2:1640285_at:342:119; Interrogation_Position=615; Antisense; AGCTCCAGCTGATGCAGCGGCTCCA
>probe:Drosophila_2:1640285_at:101:121; Interrogation_Position=630; Antisense; AGCGGCTCCAGCTGCCGAGGCTGCT
>probe:Drosophila_2:1640285_at:280:71; Interrogation_Position=647; Antisense; AGGCTGCTCCAGCTGAAGCACCTGC

Paste this into a BLAST search page for me
AAGCCGGACCAGATGGTGCGCCCGCTGCGCCCGCTGCACCCGGAGAGGAAGCCATTCGAGTACTCGATCGATCTGAGGGTGCCGAGGTGCCCTATGTCAAAGGTGCCCTATGTCAAGAACTACGAATGTCAAGAACTACGAGCCACCACCGAGCCAGTGCCAGCCGCTGAAGGAGTGAGGGTGCTGCTCCACCCGCAGAACAGAAGGCGCTGTTCCTCCAGCTGATGTTCCTCCAGCTGACGGTGCTGCTTGACGGTGCTGCTCCGCCAGCTGAGAGCTCCAGCTGATGCAGCGGCTCCAAGCGGCTCCAGCTGCCGAGGCTGCTAGGCTGCTCCAGCTGAAGCACCTGC

Full Affymetrix probeset data:

Annotations for 1640285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720