FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640286_at:

>probe:Drosophila_2:1640286_at:614:151; Interrogation_Position=285; Antisense; ACATGATCGCCTGTTTGGGTGAGAC
>probe:Drosophila_2:1640286_at:100:693; Interrogation_Position=337; Antisense; TTTGGACACCATGCAAGCCAGCGAG
>probe:Drosophila_2:1640286_at:319:157; Interrogation_Position=399; Antisense; ACACCAGCACCATTGACTTCAAGTA
>probe:Drosophila_2:1640286_at:206:389; Interrogation_Position=428; Antisense; GAAACTTTGCCACCGGATACCTTTG
>probe:Drosophila_2:1640286_at:517:455; Interrogation_Position=443; Antisense; GATACCTTTGGAGCCGCTTACGTAA
>probe:Drosophila_2:1640286_at:399:453; Interrogation_Position=479; Antisense; GATAATCAAGTCACGCCGGACAGTC
>probe:Drosophila_2:1640286_at:501:75; Interrogation_Position=521; Antisense; TTGGAGGACCCGAAGTTGGCCTACT
>probe:Drosophila_2:1640286_at:232:467; Interrogation_Position=535; Antisense; GTTGGCCTACTTGATGACGCGATAT
>probe:Drosophila_2:1640286_at:562:457; Interrogation_Position=555; Antisense; GATATCGCGAATGCCACGACCTAAT
>probe:Drosophila_2:1640286_at:155:329; Interrogation_Position=677; Antisense; GCGGTATTCGGAGCAGTTCGCCTAC
>probe:Drosophila_2:1640286_at:387:263; Interrogation_Position=710; Antisense; CAGCGGCGTGCGTACTTGAAGCATT
>probe:Drosophila_2:1640286_at:255:723; Interrogation_Position=725; Antisense; TTGAAGCATTACTTGCCGTGGGCCC
>probe:Drosophila_2:1640286_at:662:625; Interrogation_Position=780; Antisense; TGCCCGTCTACTGGGAGAAGCGCTG
>probe:Drosophila_2:1640286_at:685:323; Interrogation_Position=826; Antisense; GCGCTCCGAATTGGGCATTACTGTG

Paste this into a BLAST search page for me
ACATGATCGCCTGTTTGGGTGAGACTTTGGACACCATGCAAGCCAGCGAGACACCAGCACCATTGACTTCAAGTAGAAACTTTGCCACCGGATACCTTTGGATACCTTTGGAGCCGCTTACGTAAGATAATCAAGTCACGCCGGACAGTCTTGGAGGACCCGAAGTTGGCCTACTGTTGGCCTACTTGATGACGCGATATGATATCGCGAATGCCACGACCTAATGCGGTATTCGGAGCAGTTCGCCTACCAGCGGCGTGCGTACTTGAAGCATTTTGAAGCATTACTTGCCGTGGGCCCTGCCCGTCTACTGGGAGAAGCGCTGGCGCTCCGAATTGGGCATTACTGTG

Full Affymetrix probeset data:

Annotations for 1640286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720