Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640289_a_at:

>probe:Drosophila_2:1640289_a_at:685:175; Interrogation_Position=124; Antisense; AAACTCTTCGTTCGTCACACAAGTA
>probe:Drosophila_2:1640289_a_at:306:543; Interrogation_Position=150; Antisense; GGATTTCAAAATTCAGACGACTTTC
>probe:Drosophila_2:1640289_a_at:479:409; Interrogation_Position=165; Antisense; GACGACTTTCTGTTGGTCATACGAA
>probe:Drosophila_2:1640289_a_at:81:1; Interrogation_Position=182; Antisense; CATACGAATCGTGTCAAAGTTTTAC
>probe:Drosophila_2:1640289_a_at:111:1; Interrogation_Position=237; Antisense; ACTCAATTTTCGTGTATTAACCCTG
>probe:Drosophila_2:1640289_a_at:383:481; Interrogation_Position=250; Antisense; GTATTAACCCTGAAATGAGCCGGCA
>probe:Drosophila_2:1640289_a_at:675:231; Interrogation_Position=263; Antisense; AATGAGCCGGCATGCACATCTTGTG
>probe:Drosophila_2:1640289_a_at:289:509; Interrogation_Position=285; Antisense; GTGCTATCAGCACGCTATTCTGAGT
>probe:Drosophila_2:1640289_a_at:239:93; Interrogation_Position=307; Antisense; AGTTAAGAAGCCATCTCGAGCATTG
>probe:Drosophila_2:1640289_a_at:34:637; Interrogation_Position=322; Antisense; TCGAGCATTGGGAGTTCTTGGAAAA
>probe:Drosophila_2:1640289_a_at:412:235; Interrogation_Position=361; Antisense; AATCTTTTGGATGGGACACACGGCT
>probe:Drosophila_2:1640289_a_at:12:565; Interrogation_Position=408; Antisense; GGAAGGCATATACATCAACTAACAA
>probe:Drosophila_2:1640289_a_at:215:541; Interrogation_Position=437; Antisense; GGTTTTCCAATACCGTCACATGCAT
>probe:Drosophila_2:1640289_a_at:398:703; Interrogation_Position=531; Antisense; TTATTAGCCAGGTAACAATCCAAAT

Paste this into a BLAST search page for me
AAACTCTTCGTTCGTCACACAAGTAGGATTTCAAAATTCAGACGACTTTCGACGACTTTCTGTTGGTCATACGAACATACGAATCGTGTCAAAGTTTTACACTCAATTTTCGTGTATTAACCCTGGTATTAACCCTGAAATGAGCCGGCAAATGAGCCGGCATGCACATCTTGTGGTGCTATCAGCACGCTATTCTGAGTAGTTAAGAAGCCATCTCGAGCATTGTCGAGCATTGGGAGTTCTTGGAAAAAATCTTTTGGATGGGACACACGGCTGGAAGGCATATACATCAACTAACAAGGTTTTCCAATACCGTCACATGCATTTATTAGCCAGGTAACAATCCAAAT

Full Affymetrix probeset data:

Annotations for 1640289_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime