FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640290_at:

>probe:Drosophila_2:1640290_at:562:417; Interrogation_Position=1080; Antisense; GAGCGATCTGCCAGAGATTGTGCCC
>probe:Drosophila_2:1640290_at:655:111; Interrogation_Position=1107; Antisense; AGCACCACAACATCGATGAGCGTCG
>probe:Drosophila_2:1640290_at:384:55; Interrogation_Position=1122; Antisense; ATGAGCGTCGCATGGTGATCTTCGG
>probe:Drosophila_2:1640290_at:351:461; Interrogation_Position=1158; Antisense; GATTCATTCGCTGCATCCACAAGTA
>probe:Drosophila_2:1640290_at:406:617; Interrogation_Position=1169; Antisense; TGCATCCACAAGTACCCGGTGTTTA
>probe:Drosophila_2:1640290_at:70:719; Interrogation_Position=1207; Antisense; TTCCGGGCGGCAGAAGATGTACACC
>probe:Drosophila_2:1640290_at:227:599; Interrogation_Position=1224; Antisense; TGTACACCGGGCTGATCAGCTTTGA
>probe:Drosophila_2:1640290_at:47:427; Interrogation_Position=1250; Antisense; GAGATCTGCTGCAAGACGGGCCTCT
>probe:Drosophila_2:1640290_at:477:77; Interrogation_Position=1332; Antisense; AGTGACGACCGGAAGGACTTCTCCG
>probe:Drosophila_2:1640290_at:187:113; Interrogation_Position=1383; Antisense; AGCGAACCGATTGTTATGTTTCCAA
>probe:Drosophila_2:1640290_at:104:107; Interrogation_Position=1447; Antisense; AGAATTCACTGGTTTGGCTTGGGCT
>probe:Drosophila_2:1640290_at:598:573; Interrogation_Position=1468; Antisense; GGCTGGTTCCGGAATCGCTTTGCCA
>probe:Drosophila_2:1640290_at:622:35; Interrogation_Position=1504; Antisense; ATCAGGAATCCTTTGCGCTAGAGAT
>probe:Drosophila_2:1640290_at:534:427; Interrogation_Position=1524; Antisense; GAGATAATGCAATCCTGAACCGCCT

Paste this into a BLAST search page for me
GAGCGATCTGCCAGAGATTGTGCCCAGCACCACAACATCGATGAGCGTCGATGAGCGTCGCATGGTGATCTTCGGGATTCATTCGCTGCATCCACAAGTATGCATCCACAAGTACCCGGTGTTTATTCCGGGCGGCAGAAGATGTACACCTGTACACCGGGCTGATCAGCTTTGAGAGATCTGCTGCAAGACGGGCCTCTAGTGACGACCGGAAGGACTTCTCCGAGCGAACCGATTGTTATGTTTCCAAAGAATTCACTGGTTTGGCTTGGGCTGGCTGGTTCCGGAATCGCTTTGCCAATCAGGAATCCTTTGCGCTAGAGATGAGATAATGCAATCCTGAACCGCCT

Full Affymetrix probeset data:

Annotations for 1640290_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720