FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640291_at:

>probe:Drosophila_2:1640291_at:155:149; Interrogation_Position=3239; Antisense; ACTTATATGGGTATGTGCATTTGAC
>probe:Drosophila_2:1640291_at:43:509; Interrogation_Position=3253; Antisense; GTGCATTTGACGTATGCGTTCAGAA
>probe:Drosophila_2:1640291_at:650:405; Interrogation_Position=3261; Antisense; GACGTATGCGTTCAGAATTAGTTTA
>probe:Drosophila_2:1640291_at:96:15; Interrogation_Position=3277; Antisense; ATTAGTTTAATAAGCCTTCGACTGA
>probe:Drosophila_2:1640291_at:636:125; Interrogation_Position=3289; Antisense; AGCCTTCGACTGAAACAAATTATGT
>probe:Drosophila_2:1640291_at:507:657; Interrogation_Position=3346; Antisense; TAAGGGCTAACTGCCAACATAGGTT
>probe:Drosophila_2:1640291_at:653:13; Interrogation_Position=3420; Antisense; ATACCGTTTCCTCATACTTATACTG
>probe:Drosophila_2:1640291_at:23:481; Interrogation_Position=3425; Antisense; GTTTCCTCATACTTATACTGCAAAT
>probe:Drosophila_2:1640291_at:383:461; Interrogation_Position=3472; Antisense; GATTTTTCCATTAAATGTGCACTTA
>probe:Drosophila_2:1640291_at:73:511; Interrogation_Position=3488; Antisense; GTGCACTTATTTTGACTTTATGTAT
>probe:Drosophila_2:1640291_at:130:431; Interrogation_Position=3519; Antisense; GAGTATCTCAATGCGGTATGTCAAC
>probe:Drosophila_2:1640291_at:231:241; Interrogation_Position=3565; Antisense; AATTACGATTTGAGTACGCTTGCAA
>probe:Drosophila_2:1640291_at:73:431; Interrogation_Position=3576; Antisense; GAGTACGCTTGCAATCGTTTATTTA
>probe:Drosophila_2:1640291_at:570:287; Interrogation_Position=3591; Antisense; CGTTTATTTATTGTGTAGGTTTCAT

Paste this into a BLAST search page for me
ACTTATATGGGTATGTGCATTTGACGTGCATTTGACGTATGCGTTCAGAAGACGTATGCGTTCAGAATTAGTTTAATTAGTTTAATAAGCCTTCGACTGAAGCCTTCGACTGAAACAAATTATGTTAAGGGCTAACTGCCAACATAGGTTATACCGTTTCCTCATACTTATACTGGTTTCCTCATACTTATACTGCAAATGATTTTTCCATTAAATGTGCACTTAGTGCACTTATTTTGACTTTATGTATGAGTATCTCAATGCGGTATGTCAACAATTACGATTTGAGTACGCTTGCAAGAGTACGCTTGCAATCGTTTATTTACGTTTATTTATTGTGTAGGTTTCAT

Full Affymetrix probeset data:

Annotations for 1640291_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720