Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640292_at:

>probe:Drosophila_2:1640292_at:355:377; Interrogation_Position=132; Antisense; GAAGCAAGCTGTTGATCAGATGAGA
>probe:Drosophila_2:1640292_at:367:423; Interrogation_Position=153; Antisense; GAGAAACAAGCACAACGAGAACGAG
>probe:Drosophila_2:1640292_at:64:383; Interrogation_Position=171; Antisense; GAACGAGAAGCGGTGTAATATCCGT
>probe:Drosophila_2:1640292_at:300:21; Interrogation_Position=18; Antisense; ATTTGGGCAGCACATGATCACGTCA
>probe:Drosophila_2:1640292_at:690:41; Interrogation_Position=207; Antisense; ATCGTTTGTCGAAGGGCAAGAAAGA
>probe:Drosophila_2:1640292_at:2:213; Interrogation_Position=224; Antisense; AAGAAAGATCTGTACAAGCAAGACC
>probe:Drosophila_2:1640292_at:139:219; Interrogation_Position=280; Antisense; AAGTACAGGTACTCCAGTCGTCCAT
>probe:Drosophila_2:1640292_at:659:487; Interrogation_Position=288; Antisense; GTACTCCAGTCGTCCATCCGTTTAA
>probe:Drosophila_2:1640292_at:45:35; Interrogation_Position=34; Antisense; ATCACGTCAGGGTCGACGTATTCGT
>probe:Drosophila_2:1640292_at:379:407; Interrogation_Position=48; Antisense; GACGTATTCGTTGATCAGACGCCTA
>probe:Drosophila_2:1640292_at:40:605; Interrogation_Position=59; Antisense; TGATCAGACGCCTAAATCTCCTGGA
>probe:Drosophila_2:1640292_at:404:103; Interrogation_Position=64; Antisense; AGACGCCTAAATCTCCTGGACGATC
>probe:Drosophila_2:1640292_at:113:277; Interrogation_Position=70; Antisense; CTAAATCTCCTGGACGATCGTTCTC
>probe:Drosophila_2:1640292_at:138:713; Interrogation_Position=90; Antisense; TTCTCTAAAGTTCGACCGGCACGAA

Paste this into a BLAST search page for me
GAAGCAAGCTGTTGATCAGATGAGAGAGAAACAAGCACAACGAGAACGAGGAACGAGAAGCGGTGTAATATCCGTATTTGGGCAGCACATGATCACGTCAATCGTTTGTCGAAGGGCAAGAAAGAAAGAAAGATCTGTACAAGCAAGACCAAGTACAGGTACTCCAGTCGTCCATGTACTCCAGTCGTCCATCCGTTTAAATCACGTCAGGGTCGACGTATTCGTGACGTATTCGTTGATCAGACGCCTATGATCAGACGCCTAAATCTCCTGGAAGACGCCTAAATCTCCTGGACGATCCTAAATCTCCTGGACGATCGTTCTCTTCTCTAAAGTTCGACCGGCACGAA

Full Affymetrix probeset data:

Annotations for 1640292_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime