FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640297_at:

>probe:Drosophila_2:1640297_at:43:241; Interrogation_Position=342; Antisense; AATCAAATATCCTTTATGCGGCAAA
>probe:Drosophila_2:1640297_at:534:611; Interrogation_Position=368; Antisense; TGACGTATCGCCAAAAGATCGTGCC
>probe:Drosophila_2:1640297_at:532:95; Interrogation_Position=383; Antisense; AGATCGTGCCGAAGCTCGACGAGAT
>probe:Drosophila_2:1640297_at:634:487; Interrogation_Position=452; Antisense; GTACCGCCGCACCAATTATGAAAAG
>probe:Drosophila_2:1640297_at:493:713; Interrogation_Position=502; Antisense; TTCAGTATGTGGCTGATTCGCCAGT
>probe:Drosophila_2:1640297_at:419:463; Interrogation_Position=516; Antisense; GATTCGCCAGTTCTTTATTGCAATA
>probe:Drosophila_2:1640297_at:52:249; Interrogation_Position=574; Antisense; AATTGGCGCTTTTTGACTTGGACTA
>probe:Drosophila_2:1640297_at:347:681; Interrogation_Position=597; Antisense; TATGTCATCTTCAATCTCGATCCGA
>probe:Drosophila_2:1640297_at:676:635; Interrogation_Position=613; Antisense; TCGATCCGATCCATTTGAGGGCCTG
>probe:Drosophila_2:1640297_at:99:21; Interrogation_Position=625; Antisense; ATTTGAGGGCCTGGCTCTATAGAGC
>probe:Drosophila_2:1640297_at:332:419; Interrogation_Position=652; Antisense; GAGCTCTTGCTCGTCTGAACAATGA
>probe:Drosophila_2:1640297_at:644:39; Interrogation_Position=677; Antisense; ATCGGAATTCGAAATCGCCATCGCC
>probe:Drosophila_2:1640297_at:161:311; Interrogation_Position=699; Antisense; GCCAATGCCAGACTCCTAAACAGAT
>probe:Drosophila_2:1640297_at:616:279; Interrogation_Position=815; Antisense; CTAAGAGTTTGTATCGCGGGTGAAA

Paste this into a BLAST search page for me
AATCAAATATCCTTTATGCGGCAAATGACGTATCGCCAAAAGATCGTGCCAGATCGTGCCGAAGCTCGACGAGATGTACCGCCGCACCAATTATGAAAAGTTCAGTATGTGGCTGATTCGCCAGTGATTCGCCAGTTCTTTATTGCAATAAATTGGCGCTTTTTGACTTGGACTATATGTCATCTTCAATCTCGATCCGATCGATCCGATCCATTTGAGGGCCTGATTTGAGGGCCTGGCTCTATAGAGCGAGCTCTTGCTCGTCTGAACAATGAATCGGAATTCGAAATCGCCATCGCCGCCAATGCCAGACTCCTAAACAGATCTAAGAGTTTGTATCGCGGGTGAAA

Full Affymetrix probeset data:

Annotations for 1640297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720