FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640298_at:

>probe:Drosophila_2:1640298_at:599:407; Interrogation_Position=123; Antisense; GACGGAGAAGTACCAGCCAATTAGA
>probe:Drosophila_2:1640298_at:692:605; Interrogation_Position=149; Antisense; TGATCCTGGCCAACAGTGACTCTAC
>probe:Drosophila_2:1640298_at:326:363; Interrogation_Position=223; Antisense; GAATTCGTGAAGGTGCCGCGCAGCC
>probe:Drosophila_2:1640298_at:68:595; Interrogation_Position=254; Antisense; TGGGCCAATCCTGGCTAAGCAGCAT
>probe:Drosophila_2:1640298_at:492:657; Interrogation_Position=269; Antisense; TAAGCAGCATCTTCACCAGCCTGTG
>probe:Drosophila_2:1640298_at:697:595; Interrogation_Position=290; Antisense; TGTGGGCGCTTCTCTGGAGCTGCTA
>probe:Drosophila_2:1640298_at:166:119; Interrogation_Position=307; Antisense; AGCTGCTATCTGGTCTGGCGTGATC
>probe:Drosophila_2:1640298_at:717:193; Interrogation_Position=338; Antisense; AACTGATCCTCTGCAATGGACCCGG
>probe:Drosophila_2:1640298_at:493:129; Interrogation_Position=37; Antisense; ACCTACGTAATACTGGGCTCTGGCG
>probe:Drosophila_2:1640298_at:7:625; Interrogation_Position=416; Antisense; TGCCCTCGCACTCCAGAATAGTGTT
>probe:Drosophila_2:1640298_at:322:25; Interrogation_Position=433; Antisense; ATAGTGTTCGTGGAGAGCTTCTGCC
>probe:Drosophila_2:1640298_at:133:467; Interrogation_Position=531; Antisense; GTTGGCCACGCGCTATTTGGATAAA
>probe:Drosophila_2:1640298_at:248:505; Interrogation_Position=562; Antisense; GTGCGATATTTTGGGCGAATCCTGT
>probe:Drosophila_2:1640298_at:533:321; Interrogation_Position=94; Antisense; GCGCTGCTGCAACAGACAGACATCG

Paste this into a BLAST search page for me
GACGGAGAAGTACCAGCCAATTAGATGATCCTGGCCAACAGTGACTCTACGAATTCGTGAAGGTGCCGCGCAGCCTGGGCCAATCCTGGCTAAGCAGCATTAAGCAGCATCTTCACCAGCCTGTGTGTGGGCGCTTCTCTGGAGCTGCTAAGCTGCTATCTGGTCTGGCGTGATCAACTGATCCTCTGCAATGGACCCGGACCTACGTAATACTGGGCTCTGGCGTGCCCTCGCACTCCAGAATAGTGTTATAGTGTTCGTGGAGAGCTTCTGCCGTTGGCCACGCGCTATTTGGATAAAGTGCGATATTTTGGGCGAATCCTGTGCGCTGCTGCAACAGACAGACATCG

Full Affymetrix probeset data:

Annotations for 1640298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720