FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640299_at:

>probe:Drosophila_2:1640299_at:337:267; Interrogation_Position=166; Antisense; CAGTGTAGGACTTAGTGCCGGCATC
>probe:Drosophila_2:1640299_at:148:479; Interrogation_Position=18; Antisense; GTTTCATCCAAGAAGCGCTCGTTAT
>probe:Drosophila_2:1640299_at:282:583; Interrogation_Position=229; Antisense; TGGCTATCCTGGTGGCTATGCGAGT
>probe:Drosophila_2:1640299_at:19:51; Interrogation_Position=246; Antisense; ATGCGAGTGGCTACCCAGGTGGCTA
>probe:Drosophila_2:1640299_at:273:681; Interrogation_Position=269; Antisense; TATGGTGGTGGCTACTCAGGCTATA
>probe:Drosophila_2:1640299_at:487:337; Interrogation_Position=34; Antisense; GCTCGTTATCGCAATGGCTCTGGTT
>probe:Drosophila_2:1640299_at:79:75; Interrogation_Position=340; Antisense; AGGTTACTCCGGCTTTGGACACAGG
>probe:Drosophila_2:1640299_at:430:47; Interrogation_Position=387; Antisense; ATCCGGGCGGTGGATCGTACCACAA
>probe:Drosophila_2:1640299_at:643:485; Interrogation_Position=403; Antisense; GTACCACAATCAGGGCGGATCTTAT
>probe:Drosophila_2:1640299_at:361:681; Interrogation_Position=425; Antisense; TATGGCGGCCACTATAGTCAGTCAC
>probe:Drosophila_2:1640299_at:676:95; Interrogation_Position=527; Antisense; AGATGCCAAATCTTGCCACCGGGAT
>probe:Drosophila_2:1640299_at:583:489; Interrogation_Position=558; Antisense; GTACTTGTGATTGACCCTTTGTAGA
>probe:Drosophila_2:1640299_at:308:635; Interrogation_Position=58; Antisense; TCGCGTGAGTTGTATGCTGGCCCTT
>probe:Drosophila_2:1640299_at:557:319; Interrogation_Position=77; Antisense; GCCCTTTTGCTGATTGCCGGTCAAG

Paste this into a BLAST search page for me
CAGTGTAGGACTTAGTGCCGGCATCGTTTCATCCAAGAAGCGCTCGTTATTGGCTATCCTGGTGGCTATGCGAGTATGCGAGTGGCTACCCAGGTGGCTATATGGTGGTGGCTACTCAGGCTATAGCTCGTTATCGCAATGGCTCTGGTTAGGTTACTCCGGCTTTGGACACAGGATCCGGGCGGTGGATCGTACCACAAGTACCACAATCAGGGCGGATCTTATTATGGCGGCCACTATAGTCAGTCACAGATGCCAAATCTTGCCACCGGGATGTACTTGTGATTGACCCTTTGTAGATCGCGTGAGTTGTATGCTGGCCCTTGCCCTTTTGCTGATTGCCGGTCAAG

Full Affymetrix probeset data:

Annotations for 1640299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720