FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640300_at:

>probe:Drosophila_2:1640300_at:4:95; Interrogation_Position=3939; Antisense; AGATCGACGAGGTGGACGCCGAACT
>probe:Drosophila_2:1640300_at:353:341; Interrogation_Position=3990; Antisense; GCTAGGTGGCTGGATCTCCACGCAT
>probe:Drosophila_2:1640300_at:637:47; Interrogation_Position=4019; Antisense; ATCCATACGCGACATAGGCTGCAGC
>probe:Drosophila_2:1640300_at:125:233; Interrogation_Position=4049; Antisense; AATGCAGCTGCTGTAATTACTGGTA
>probe:Drosophila_2:1640300_at:125:399; Interrogation_Position=4092; Antisense; GACAGCTTACGTACATTTATTTTAG
>probe:Drosophila_2:1640300_at:560:397; Interrogation_Position=4216; Antisense; GACAAGACGCCTTCGATTCTTTTTA
>probe:Drosophila_2:1640300_at:341:461; Interrogation_Position=4230; Antisense; GATTCTTTTTAGGTTCTGTCTCTAC
>probe:Drosophila_2:1640300_at:506:599; Interrogation_Position=4246; Antisense; TGTCTCTACATATATTCTTTCCTCC
>probe:Drosophila_2:1640300_at:312:269; Interrogation_Position=4270; Antisense; CCCCTAACCACACCTTTGAATATAT
>probe:Drosophila_2:1640300_at:145:541; Interrogation_Position=4327; Antisense; GGTTCTCTTCCTAGCGCATAAGTTA
>probe:Drosophila_2:1640300_at:104:489; Interrogation_Position=4369; Antisense; GTACGCCTCGTATTGCAACAGTGCT
>probe:Drosophila_2:1640300_at:381:481; Interrogation_Position=4453; Antisense; GTATTACGCATGCAACTAACACCCA
>probe:Drosophila_2:1640300_at:368:531; Interrogation_Position=4486; Antisense; GGGTCACTTTGATCAACTGCTTGGC
>probe:Drosophila_2:1640300_at:117:143; Interrogation_Position=4501; Antisense; ACTGCTTGGCAATGCTTTTATCTAC

Paste this into a BLAST search page for me
AGATCGACGAGGTGGACGCCGAACTGCTAGGTGGCTGGATCTCCACGCATATCCATACGCGACATAGGCTGCAGCAATGCAGCTGCTGTAATTACTGGTAGACAGCTTACGTACATTTATTTTAGGACAAGACGCCTTCGATTCTTTTTAGATTCTTTTTAGGTTCTGTCTCTACTGTCTCTACATATATTCTTTCCTCCCCCCTAACCACACCTTTGAATATATGGTTCTCTTCCTAGCGCATAAGTTAGTACGCCTCGTATTGCAACAGTGCTGTATTACGCATGCAACTAACACCCAGGGTCACTTTGATCAACTGCTTGGCACTGCTTGGCAATGCTTTTATCTAC

Full Affymetrix probeset data:

Annotations for 1640300_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720