FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640306_at:

>probe:Drosophila_2:1640306_at:575:543; Interrogation_Position=226; Antisense; GGATACCCGACTAGCAGACTTCAAG
>probe:Drosophila_2:1640306_at:433:83; Interrogation_Position=249; Antisense; AGTGGCCACTGGTACAATTCGCTAT
>probe:Drosophila_2:1640306_at:522:553; Interrogation_Position=283; Antisense; GGAGCTGTTTATTACCCAGACGCCA
>probe:Drosophila_2:1640306_at:258:683; Interrogation_Position=325; Antisense; TATGACAGTCCCAAGTACCAGAATG
>probe:Drosophila_2:1640306_at:539:425; Interrogation_Position=373; Antisense; GAGAGCATTACCTTTAACGCACTAA
>probe:Drosophila_2:1640306_at:206:659; Interrogation_Position=395; Antisense; TAACTCAGGCGGTTGAACTACCCAC
>probe:Drosophila_2:1640306_at:186:151; Interrogation_Position=418; Antisense; ACATCCCCTTTTCCAAGAGGAGCTT
>probe:Drosophila_2:1640306_at:246:117; Interrogation_Position=438; Antisense; AGCTTCGGAGCTGGTTTTCACCGGA
>probe:Drosophila_2:1640306_at:716:431; Interrogation_Position=544; Antisense; GAGTCCATGATGTCTGCCTACGAGG
>probe:Drosophila_2:1640306_at:100:555; Interrogation_Position=580; Antisense; GGACCTTGCCATATTTGTGCTTATC
>probe:Drosophila_2:1640306_at:347:21; Interrogation_Position=614; Antisense; ATATTGGAGCCTGCCACGGAGATTC
>probe:Drosophila_2:1640306_at:386:549; Interrogation_Position=640; Antisense; GGAGGTCCTCTAGTTCACCAGGGCA
>probe:Drosophila_2:1640306_at:676:517; Interrogation_Position=670; Antisense; GTGGGCATACTCAACTTCTTTGTAC
>probe:Drosophila_2:1640306_at:498:489; Interrogation_Position=735; Antisense; GTACTACCGCGACTGGATGCGACAA

Paste this into a BLAST search page for me
GGATACCCGACTAGCAGACTTCAAGAGTGGCCACTGGTACAATTCGCTATGGAGCTGTTTATTACCCAGACGCCATATGACAGTCCCAAGTACCAGAATGGAGAGCATTACCTTTAACGCACTAATAACTCAGGCGGTTGAACTACCCACACATCCCCTTTTCCAAGAGGAGCTTAGCTTCGGAGCTGGTTTTCACCGGAGAGTCCATGATGTCTGCCTACGAGGGGACCTTGCCATATTTGTGCTTATCATATTGGAGCCTGCCACGGAGATTCGGAGGTCCTCTAGTTCACCAGGGCAGTGGGCATACTCAACTTCTTTGTACGTACTACCGCGACTGGATGCGACAA

Full Affymetrix probeset data:

Annotations for 1640306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720