FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640307_at:

>probe:Drosophila_2:1640307_at:713:567; Interrogation_Position=1036; Antisense; GGCACCATGAGTAGTGCCTCCATGG
>probe:Drosophila_2:1640307_at:13:51; Interrogation_Position=1069; Antisense; ATGCCGGGCATGCTGATGGACTACC
>probe:Drosophila_2:1640307_at:235:37; Interrogation_Position=1094; Antisense; ATCATAGTCACCACAGCGGCAGTGC
>probe:Drosophila_2:1640307_at:640:631; Interrogation_Position=1187; Antisense; TCCTGGGCACGATCCACAATGGACA
>probe:Drosophila_2:1640307_at:177:115; Interrogation_Position=1226; Antisense; AGCAGTATCATCACGAGTGCATCCA
>probe:Drosophila_2:1640307_at:436:433; Interrogation_Position=1240; Antisense; GAGTGCATCCACTACGAGCGATTGC
>probe:Drosophila_2:1640307_at:223:353; Interrogation_Position=1314; Antisense; GCAGCAGATGTCACAGCACCAGCTT
>probe:Drosophila_2:1640307_at:709:295; Interrogation_Position=1356; Antisense; CGAGCCAGCCTATGCGACAGTTATG
>probe:Drosophila_2:1640307_at:574:265; Interrogation_Position=1373; Antisense; CAGTTATGGCTGTTTCGGGCAGCTA
>probe:Drosophila_2:1640307_at:10:267; Interrogation_Position=820; Antisense; CAGGGTCACGACTCTGGATCGGATT
>probe:Drosophila_2:1640307_at:449:273; Interrogation_Position=845; Antisense; CTAGTCAAGGTTGCGGCGGATCCAT
>probe:Drosophila_2:1640307_at:529:269; Interrogation_Position=879; Antisense; CATGTTGGTCATGGGTCATCCGGGC
>probe:Drosophila_2:1640307_at:303:25; Interrogation_Position=905; Antisense; ATATGGGCAGCTTGGGTCACCACAG
>probe:Drosophila_2:1640307_at:71:535; Interrogation_Position=953; Antisense; GGTGCTCGAGCAGATGTCACAATAC

Paste this into a BLAST search page for me
GGCACCATGAGTAGTGCCTCCATGGATGCCGGGCATGCTGATGGACTACCATCATAGTCACCACAGCGGCAGTGCTCCTGGGCACGATCCACAATGGACAAGCAGTATCATCACGAGTGCATCCAGAGTGCATCCACTACGAGCGATTGCGCAGCAGATGTCACAGCACCAGCTTCGAGCCAGCCTATGCGACAGTTATGCAGTTATGGCTGTTTCGGGCAGCTACAGGGTCACGACTCTGGATCGGATTCTAGTCAAGGTTGCGGCGGATCCATCATGTTGGTCATGGGTCATCCGGGCATATGGGCAGCTTGGGTCACCACAGGGTGCTCGAGCAGATGTCACAATAC

Full Affymetrix probeset data:

Annotations for 1640307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720