FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640310_at:

>probe:Drosophila_2:1640310_at:339:657; Interrogation_Position=1128; Antisense; TAATGGGCGTGACCATCCAGCCGGA
>probe:Drosophila_2:1640310_at:155:519; Interrogation_Position=1166; Antisense; GTGGGACCCATCTTTCTGTTCATGC
>probe:Drosophila_2:1640310_at:6:339; Interrogation_Position=1189; Antisense; GCTCATCCCTCTATGGCAGTATATA
>probe:Drosophila_2:1640310_at:506:479; Interrogation_Position=1207; Antisense; GTATATAACAGTGCCCTTGCTGCGC
>probe:Drosophila_2:1640310_at:478:123; Interrogation_Position=1254; Antisense; AGCCGCTCCATAGTGTGACTGTGGG
>probe:Drosophila_2:1640310_at:223:511; Interrogation_Position=1355; Antisense; GTGAATATAGCTTGGCAACTGCCCC
>probe:Drosophila_2:1640310_at:359:631; Interrogation_Position=1383; Antisense; TCCTGCTGCTCATGATGGGCGAATT
>probe:Drosophila_2:1640310_at:191:363; Interrogation_Position=1403; Antisense; GAATTACTGCTTTCCATTCCGGGTC
>probe:Drosophila_2:1640310_at:675:493; Interrogation_Position=1472; Antisense; GTCACGGCAGCCTGGTTTCTAAATA
>probe:Drosophila_2:1640310_at:348:53; Interrogation_Position=1497; Antisense; ATGCTTTCGGCAATCTGATCGTGGT
>probe:Drosophila_2:1640310_at:232:605; Interrogation_Position=1512; Antisense; TGATCGTGGTTCTGGTCACCGAGCT
>probe:Drosophila_2:1640310_at:59:485; Interrogation_Position=1539; Antisense; GTATGCTTAGCTCACAGATGGCCGA
>probe:Drosophila_2:1640310_at:561:429; Interrogation_Position=1562; Antisense; GAGTACTTCTTCTATGCGGTGGTAA
>probe:Drosophila_2:1640310_at:409:701; Interrogation_Position=1614; Antisense; TTTTGGCCTTCGATTACACTCTGCA

Paste this into a BLAST search page for me
TAATGGGCGTGACCATCCAGCCGGAGTGGGACCCATCTTTCTGTTCATGCGCTCATCCCTCTATGGCAGTATATAGTATATAACAGTGCCCTTGCTGCGCAGCCGCTCCATAGTGTGACTGTGGGGTGAATATAGCTTGGCAACTGCCCCTCCTGCTGCTCATGATGGGCGAATTGAATTACTGCTTTCCATTCCGGGTCGTCACGGCAGCCTGGTTTCTAAATAATGCTTTCGGCAATCTGATCGTGGTTGATCGTGGTTCTGGTCACCGAGCTGTATGCTTAGCTCACAGATGGCCGAGAGTACTTCTTCTATGCGGTGGTAATTTTGGCCTTCGATTACACTCTGCA

Full Affymetrix probeset data:

Annotations for 1640310_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720