Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640312_at:

>probe:Drosophila_2:1640312_at:563:49; Interrogation_Position=3455; Antisense; ATGCCATGTACGTTGGACTCTCTGA
>probe:Drosophila_2:1640312_at:726:589; Interrogation_Position=3490; Antisense; TGGTCCATGCCCGAGGTAATGCTGC
>probe:Drosophila_2:1640312_at:369:491; Interrogation_Position=3505; Antisense; GTAATGCTGCAACCGCTTTTGGCGA
>probe:Drosophila_2:1640312_at:245:425; Interrogation_Position=3528; Antisense; GAGACTGCGTCTGGATGAAACCTGC
>probe:Drosophila_2:1640312_at:601:661; Interrogation_Position=3573; Antisense; TAAAGAGTGGCTCCTACGGCCGGAC
>probe:Drosophila_2:1640312_at:281:113; Interrogation_Position=3663; Antisense; AGCAGGAACTTCCACCTCAATGAAT
>probe:Drosophila_2:1640312_at:194:69; Interrogation_Position=3721; Antisense; ATGGCGCCCAGTGTCCGAGATCGAG
>probe:Drosophila_2:1640312_at:655:693; Interrogation_Position=3757; Antisense; TTTGCCCTTCTGCTGGAGAACACTT
>probe:Drosophila_2:1640312_at:332:423; Interrogation_Position=3772; Antisense; GAGAACACTTGCAACGCCGTGGAGA
>probe:Drosophila_2:1640312_at:533:217; Interrogation_Position=3825; Antisense; AAGTATGCTTCTTGATATCGTCCGA
>probe:Drosophila_2:1640312_at:393:395; Interrogation_Position=3848; Antisense; GAAATACGCTGCTGGATTACGCCCA
>probe:Drosophila_2:1640312_at:159:543; Interrogation_Position=3861; Antisense; GGATTACGCCCAGCTAGATGTCTAC
>probe:Drosophila_2:1640312_at:527:99; Interrogation_Position=3876; Antisense; AGATGTCTACCTGCGGAATCTCATG
>probe:Drosophila_2:1640312_at:396:563; Interrogation_Position=3890; Antisense; GGAATCTCATGTGCGAGCTGTTGAA

Paste this into a BLAST search page for me
ATGCCATGTACGTTGGACTCTCTGATGGTCCATGCCCGAGGTAATGCTGCGTAATGCTGCAACCGCTTTTGGCGAGAGACTGCGTCTGGATGAAACCTGCTAAAGAGTGGCTCCTACGGCCGGACAGCAGGAACTTCCACCTCAATGAATATGGCGCCCAGTGTCCGAGATCGAGTTTGCCCTTCTGCTGGAGAACACTTGAGAACACTTGCAACGCCGTGGAGAAAGTATGCTTCTTGATATCGTCCGAGAAATACGCTGCTGGATTACGCCCAGGATTACGCCCAGCTAGATGTCTACAGATGTCTACCTGCGGAATCTCATGGGAATCTCATGTGCGAGCTGTTGAA

Full Affymetrix probeset data:

Annotations for 1640312_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime