FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640314_at:

>probe:Drosophila_2:1640314_at:4:449; Interrogation_Position=213; Antisense; GATCCCTTTGAGCTCCTCAATGAGA
>probe:Drosophila_2:1640314_at:342:429; Interrogation_Position=276; Antisense; GAGTATCAGGAGGTGGTCAACGCTA
>probe:Drosophila_2:1640314_at:498:537; Interrogation_Position=290; Antisense; GGTCAACGCTATTGATGCGCAGAAC
>probe:Drosophila_2:1640314_at:106:103; Interrogation_Position=326; Antisense; AGAGCTCAAGGCAAAGTCCAATCGA
>probe:Drosophila_2:1640314_at:379:87; Interrogation_Position=340; Antisense; AGTCCAATCGACTGATGTTCAAGAA
>probe:Drosophila_2:1640314_at:218:449; Interrogation_Position=428; Antisense; GATCCATTTAAAGGTTCTCGTGAAT
>probe:Drosophila_2:1640314_at:331:511; Interrogation_Position=447; Antisense; GTGAATAGAGCCATGCACCTCCAAA
>probe:Drosophila_2:1640314_at:393:639; Interrogation_Position=475; Antisense; TCGGTTCACCTAGGCGCTACAGAGA
>probe:Drosophila_2:1640314_at:484:375; Interrogation_Position=527; Antisense; GAAGAGCTACTTTTATACTGAACTA
>probe:Drosophila_2:1640314_at:67:385; Interrogation_Position=546; Antisense; GAACTACAATCGACCTTATCAGGCT
>probe:Drosophila_2:1640314_at:595:703; Interrogation_Position=561; Antisense; TTATCAGGCTTTTGTCCCACGGATT
>probe:Drosophila_2:1640314_at:269:729; Interrogation_Position=572; Antisense; TTGTCCCACGGATTCGGCTGACGAA
>probe:Drosophila_2:1640314_at:727:459; Interrogation_Position=631; Antisense; GTTGTACCTAGTTTCCTAGCGGAGT
>probe:Drosophila_2:1640314_at:589:151; Interrogation_Position=739; Antisense; ACATATCAACGACACTGCACTCAAT

Paste this into a BLAST search page for me
GATCCCTTTGAGCTCCTCAATGAGAGAGTATCAGGAGGTGGTCAACGCTAGGTCAACGCTATTGATGCGCAGAACAGAGCTCAAGGCAAAGTCCAATCGAAGTCCAATCGACTGATGTTCAAGAAGATCCATTTAAAGGTTCTCGTGAATGTGAATAGAGCCATGCACCTCCAAATCGGTTCACCTAGGCGCTACAGAGAGAAGAGCTACTTTTATACTGAACTAGAACTACAATCGACCTTATCAGGCTTTATCAGGCTTTTGTCCCACGGATTTTGTCCCACGGATTCGGCTGACGAAGTTGTACCTAGTTTCCTAGCGGAGTACATATCAACGACACTGCACTCAAT

Full Affymetrix probeset data:

Annotations for 1640314_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720