FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640315_at:

>probe:Drosophila_2:1640315_at:613:533; Interrogation_Position=1480; Antisense; GGTGACACCCGAGAAGATTGCCAAA
>probe:Drosophila_2:1640315_at:253:407; Interrogation_Position=1518; Antisense; GACTGGCCTGCGACGTGATCGTAGA
>probe:Drosophila_2:1640315_at:674:51; Interrogation_Position=1542; Antisense; ATGCTTTCTGTGGATGCGGCGGCAA
>probe:Drosophila_2:1640315_at:196:575; Interrogation_Position=1559; Antisense; GGCGGCAATGCCATTCAGTTTGCAA
>probe:Drosophila_2:1640315_at:146:187; Interrogation_Position=1583; Antisense; AACACCTGTGGACGCGTAATTGCTG
>probe:Drosophila_2:1640315_at:433:5; Interrogation_Position=1601; Antisense; ATTGCTGTGGACATCGATGCCGAGA
>probe:Drosophila_2:1640315_at:624:49; Interrogation_Position=1647; Antisense; ATGCCGGCATTTATGGTGTGGCCCA
>probe:Drosophila_2:1640315_at:160:33; Interrogation_Position=1671; Antisense; ATAAGATCGAGTTTATCCACGCCGA
>probe:Drosophila_2:1640315_at:467:461; Interrogation_Position=1694; Antisense; GATTTTCTGCAGTTTGCGGCCAGCA
>probe:Drosophila_2:1640315_at:452:323; Interrogation_Position=1726; Antisense; GCGCCCAAATGTGGTTTTCCTGAGC
>probe:Drosophila_2:1640315_at:396:115; Interrogation_Position=1779; Antisense; AGCAGGCCACCTTTGATATCGAAAC
>probe:Drosophila_2:1640315_at:211:593; Interrogation_Position=1818; Antisense; TGGGTGCTAGCCAACTGATGCAGCT
>probe:Drosophila_2:1640315_at:35:41; Interrogation_Position=1858; Antisense; ATCTGACGTAGCTTTCTTTCTGCCA
>probe:Drosophila_2:1640315_at:601:469; Interrogation_Position=1970; Antisense; GTTGCGCTCACTGCTTATTATGGTA

Paste this into a BLAST search page for me
GGTGACACCCGAGAAGATTGCCAAAGACTGGCCTGCGACGTGATCGTAGAATGCTTTCTGTGGATGCGGCGGCAAGGCGGCAATGCCATTCAGTTTGCAAAACACCTGTGGACGCGTAATTGCTGATTGCTGTGGACATCGATGCCGAGAATGCCGGCATTTATGGTGTGGCCCAATAAGATCGAGTTTATCCACGCCGAGATTTTCTGCAGTTTGCGGCCAGCAGCGCCCAAATGTGGTTTTCCTGAGCAGCAGGCCACCTTTGATATCGAAACTGGGTGCTAGCCAACTGATGCAGCTATCTGACGTAGCTTTCTTTCTGCCAGTTGCGCTCACTGCTTATTATGGTA

Full Affymetrix probeset data:

Annotations for 1640315_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720