FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640316_at:

>probe:Drosophila_2:1640316_at:551:197; Interrogation_Position=143; Antisense; AACGTGTGCGCAGAATGGAGGTCCT
>probe:Drosophila_2:1640316_at:702:371; Interrogation_Position=180; Antisense; GAAGTGGTTCAATTCCGAGCGTACA
>probe:Drosophila_2:1640316_at:717:121; Interrogation_Position=197; Antisense; AGCGTACACGCATCCTAGAGCAGTT
>probe:Drosophila_2:1640316_at:575:11; Interrogation_Position=234; Antisense; ATTCGGTCAGATTTCGGTGGAGCAT
>probe:Drosophila_2:1640316_at:67:119; Interrogation_Position=25; Antisense; AGCTCGGAGTCCCTAAACAAGATGA
>probe:Drosophila_2:1640316_at:99:39; Interrogation_Position=284; Antisense; ATCTGTATGAGCTGCGCGAGGGACT
>probe:Drosophila_2:1640316_at:287:79; Interrogation_Position=302; Antisense; AGGGACTAGACGGACTCAGCCACAT
>probe:Drosophila_2:1640316_at:701:433; Interrogation_Position=328; Antisense; GAGTGGTCTCTCTCCGATGTGGACA
>probe:Drosophila_2:1640316_at:161:27; Interrogation_Position=364; Antisense; ATAGCTGCATCAGAACTGCCATCCG
>probe:Drosophila_2:1640316_at:210:41; Interrogation_Position=397; Antisense; ATCGGTGCCCGATATGCAGGCGTAG
>probe:Drosophila_2:1640316_at:445:485; Interrogation_Position=418; Antisense; GTAGGGCTCTACACGCTGATGTGCG
>probe:Drosophila_2:1640316_at:100:441; Interrogation_Position=435; Antisense; GATGTGCGCAGGATATTCAGTCGAC
>probe:Drosophila_2:1640316_at:555:443; Interrogation_Position=66; Antisense; GATGATCTTCATGCAAGTCACCGAA
>probe:Drosophila_2:1640316_at:612:485; Interrogation_Position=82; Antisense; GTCACCGAACATCTTTTCCTAAGGG

Paste this into a BLAST search page for me
AACGTGTGCGCAGAATGGAGGTCCTGAAGTGGTTCAATTCCGAGCGTACAAGCGTACACGCATCCTAGAGCAGTTATTCGGTCAGATTTCGGTGGAGCATAGCTCGGAGTCCCTAAACAAGATGAATCTGTATGAGCTGCGCGAGGGACTAGGGACTAGACGGACTCAGCCACATGAGTGGTCTCTCTCCGATGTGGACAATAGCTGCATCAGAACTGCCATCCGATCGGTGCCCGATATGCAGGCGTAGGTAGGGCTCTACACGCTGATGTGCGGATGTGCGCAGGATATTCAGTCGACGATGATCTTCATGCAAGTCACCGAAGTCACCGAACATCTTTTCCTAAGGG

Full Affymetrix probeset data:

Annotations for 1640316_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720