FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640317_at:

>probe:Drosophila_2:1640317_at:28:67; Interrogation_Position=2012; Antisense; ATGGAGCCACTAATGCGTCTGCTAC
>probe:Drosophila_2:1640317_at:492:673; Interrogation_Position=2034; Antisense; TACCGCTGCGGACAGCTTCGAAGAG
>probe:Drosophila_2:1640317_at:41:385; Interrogation_Position=2064; Antisense; GAACTACTTCAAAATCCGCGAGGCT
>probe:Drosophila_2:1640317_at:455:379; Interrogation_Position=2122; Antisense; GAAGCCAAGCGCATTGAACTCAACA
>probe:Drosophila_2:1640317_at:436:371; Interrogation_Position=2172; Antisense; GAAGGAGGTGCATCGACTTCGAGTC
>probe:Drosophila_2:1640317_at:640:385; Interrogation_Position=2239; Antisense; GAACAACTGCGGAAGTGCTCCACTT
>probe:Drosophila_2:1640317_at:552:219; Interrogation_Position=2251; Antisense; AAGTGCTCCACTTCATGAGGTCTGG
>probe:Drosophila_2:1640317_at:342:659; Interrogation_Position=2282; Antisense; TAAGCGACGCCGACGGTGACGATGA
>probe:Drosophila_2:1640317_at:276:547; Interrogation_Position=2319; Antisense; GGATGCCTATTTGGATCGCTTCAAC
>probe:Drosophila_2:1640317_at:483:5; Interrogation_Position=2406; Antisense; ATTCCACTTTCCACACACATTTTTT
>probe:Drosophila_2:1640317_at:13:401; Interrogation_Position=2467; Antisense; GACAGCGGTGCGACTTTAGTCCATC
>probe:Drosophila_2:1640317_at:201:149; Interrogation_Position=2479; Antisense; ACTTTAGTCCATCGCTGGCCAGGAT
>probe:Drosophila_2:1640317_at:464:71; Interrogation_Position=2499; Antisense; AGGATTACCGACTAAGCCATCATAA
>probe:Drosophila_2:1640317_at:357:685; Interrogation_Position=2563; Antisense; TATACTGTGGGCGTGGCCAGCTAAT

Paste this into a BLAST search page for me
ATGGAGCCACTAATGCGTCTGCTACTACCGCTGCGGACAGCTTCGAAGAGGAACTACTTCAAAATCCGCGAGGCTGAAGCCAAGCGCATTGAACTCAACAGAAGGAGGTGCATCGACTTCGAGTCGAACAACTGCGGAAGTGCTCCACTTAAGTGCTCCACTTCATGAGGTCTGGTAAGCGACGCCGACGGTGACGATGAGGATGCCTATTTGGATCGCTTCAACATTCCACTTTCCACACACATTTTTTGACAGCGGTGCGACTTTAGTCCATCACTTTAGTCCATCGCTGGCCAGGATAGGATTACCGACTAAGCCATCATAATATACTGTGGGCGTGGCCAGCTAAT

Full Affymetrix probeset data:

Annotations for 1640317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720