FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640318_at:

>probe:Drosophila_2:1640318_at:387:37; Interrogation_Position=139; Antisense; ATCATAGCCGCCGACGTTCTGAGAA
>probe:Drosophila_2:1640318_at:167:139; Interrogation_Position=152; Antisense; ACGTTCTGAGAAGGGCGGGCATCAA
>probe:Drosophila_2:1640318_at:370:249; Interrogation_Position=174; Antisense; CAAGGTCACCGTAGCCGGTTTGAAT
>probe:Drosophila_2:1640318_at:125:221; Interrogation_Position=214; Antisense; AAGTGCTCGCGGGATGTGCAGATCC
>probe:Drosophila_2:1640318_at:342:577; Interrogation_Position=255; Antisense; GGCCCAGGTTGCCTCGGATAAGTTC
>probe:Drosophila_2:1640318_at:446:591; Interrogation_Position=338; Antisense; TGGTCGGTGACTTGCTGCGCAGCCA
>probe:Drosophila_2:1640318_at:640:307; Interrogation_Position=360; Antisense; CCAGGAGTCTGGTGGCGGACTCATC
>probe:Drosophila_2:1640318_at:106:685; Interrogation_Position=454; Antisense; TATCCCTCAATGAAGCCCCAGCTGG
>probe:Drosophila_2:1640318_at:441:125; Interrogation_Position=467; Antisense; AGCCCCAGCTGGTGAATAACTATAG
>probe:Drosophila_2:1640318_at:70:31; Interrogation_Position=482; Antisense; ATAACTATAGCTATGTGGACGACAA
>probe:Drosophila_2:1640318_at:239:237; Interrogation_Position=526; Antisense; AATCTGATCACCAGTCGAGGTCCTG
>probe:Drosophila_2:1640318_at:294:435; Interrogation_Position=542; Antisense; GAGGTCCTGGCACCGCCTACGAGTT
>probe:Drosophila_2:1640318_at:205:93; Interrogation_Position=563; Antisense; AGTTCGCCCTCAAAATCGCCGAGGA
>probe:Drosophila_2:1640318_at:697:221; Interrogation_Position=622; Antisense; AAGGGTCTTCTTGTGGCCTACAACT

Paste this into a BLAST search page for me
ATCATAGCCGCCGACGTTCTGAGAAACGTTCTGAGAAGGGCGGGCATCAACAAGGTCACCGTAGCCGGTTTGAATAAGTGCTCGCGGGATGTGCAGATCCGGCCCAGGTTGCCTCGGATAAGTTCTGGTCGGTGACTTGCTGCGCAGCCACCAGGAGTCTGGTGGCGGACTCATCTATCCCTCAATGAAGCCCCAGCTGGAGCCCCAGCTGGTGAATAACTATAGATAACTATAGCTATGTGGACGACAAAATCTGATCACCAGTCGAGGTCCTGGAGGTCCTGGCACCGCCTACGAGTTAGTTCGCCCTCAAAATCGCCGAGGAAAGGGTCTTCTTGTGGCCTACAACT

Full Affymetrix probeset data:

Annotations for 1640318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720