FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640322_at:

>probe:Drosophila_2:1640322_at:542:599; Interrogation_Position=105; Antisense; TGTCAAGGCAAAGCGCGGCATATCA
>probe:Drosophila_2:1640322_at:660:55; Interrogation_Position=13; Antisense; ATGAAATTCACTCTGCTGCTGCTCA
>probe:Drosophila_2:1640322_at:19:727; Interrogation_Position=154; Antisense; TTGGTCACCCACTCGCACTACATAG
>probe:Drosophila_2:1640322_at:441:147; Interrogation_Position=170; Antisense; ACTACATAGCTGCACCCACGCTGGT
>probe:Drosophila_2:1640322_at:392:333; Interrogation_Position=189; Antisense; GCTGGTGCATCATGCCCCAATCATA
>probe:Drosophila_2:1640322_at:131:37; Interrogation_Position=197; Antisense; ATCATGCCCCAATCATATCGCATGC
>probe:Drosophila_2:1640322_at:466:333; Interrogation_Position=243; Antisense; GCTGATTGCCCACCATCCGGTGTCT
>probe:Drosophila_2:1640322_at:395:45; Interrogation_Position=257; Antisense; ATCCGGTGTCTTCGGTGTCCTATCA
>probe:Drosophila_2:1640322_at:607:621; Interrogation_Position=26; Antisense; TGCTGCTGCTCATCGCCAGTTTGGC
>probe:Drosophila_2:1640322_at:714:513; Interrogation_Position=262; Antisense; GTGTCTTCGGTGTCCTATCACCTGC
>probe:Drosophila_2:1640322_at:140:619; Interrogation_Position=32; Antisense; TGCTCATCGCCAGTTTGGCCTGCAT
>probe:Drosophila_2:1640322_at:343:91; Interrogation_Position=43; Antisense; AGTTTGGCCTGCATCCTGGCCGCAC
>probe:Drosophila_2:1640322_at:28:75; Interrogation_Position=92; Antisense; AGGAGGAGTCCTCTGTCAAGGCAAA
>probe:Drosophila_2:1640322_at:592:431; Interrogation_Position=97; Antisense; GAGTCCTCTGTCAAGGCAAAGCGCG

Paste this into a BLAST search page for me
TGTCAAGGCAAAGCGCGGCATATCAATGAAATTCACTCTGCTGCTGCTCATTGGTCACCCACTCGCACTACATAGACTACATAGCTGCACCCACGCTGGTGCTGGTGCATCATGCCCCAATCATAATCATGCCCCAATCATATCGCATGCGCTGATTGCCCACCATCCGGTGTCTATCCGGTGTCTTCGGTGTCCTATCATGCTGCTGCTCATCGCCAGTTTGGCGTGTCTTCGGTGTCCTATCACCTGCTGCTCATCGCCAGTTTGGCCTGCATAGTTTGGCCTGCATCCTGGCCGCACAGGAGGAGTCCTCTGTCAAGGCAAAGAGTCCTCTGTCAAGGCAAAGCGCG

Full Affymetrix probeset data:

Annotations for 1640322_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720