FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640324_at:

>probe:Drosophila_2:1640324_at:253:455; Interrogation_Position=1008; Antisense; GATCAAGGAGGATGCCGAGACCGAT
>probe:Drosophila_2:1640324_at:64:49; Interrogation_Position=1019; Antisense; ATGCCGAGACCGATATTGGATACGT
>probe:Drosophila_2:1640324_at:446:19; Interrogation_Position=1031; Antisense; ATATTGGATACGTCCTGGTCACTCT
>probe:Drosophila_2:1640324_at:715:589; Interrogation_Position=1046; Antisense; TGGTCACTCTTACGGCTTGGTAGAC
>probe:Drosophila_2:1640324_at:222:275; Interrogation_Position=1061; Antisense; CTTGGTAGACGGAAGCAGCCGGAAT
>probe:Drosophila_2:1640324_at:614:317; Interrogation_Position=1078; Antisense; GCCGGAATATCCGAATATCTATGAG
>probe:Drosophila_2:1640324_at:642:683; Interrogation_Position=1093; Antisense; TATCTATGAGCAATACCCCACTGTT
>probe:Drosophila_2:1640324_at:58:111; Interrogation_Position=1101; Antisense; AGCAATACCCCACTGTTCAAGTAGA
>probe:Drosophila_2:1640324_at:280:257; Interrogation_Position=1187; Antisense; CAAATGGAGTTGGTCTATATACAGT
>probe:Drosophila_2:1640324_at:679:29; Interrogation_Position=1205; Antisense; ATACAGTAGTTGTGATGTGTTCTAA
>probe:Drosophila_2:1640324_at:344:441; Interrogation_Position=1218; Antisense; GATGTGTTCTAAAAATCCAATCTAC
>probe:Drosophila_2:1640324_at:599:161; Interrogation_Position=1230; Antisense; AAATCCAATCTACAAAACGCTTAGT
>probe:Drosophila_2:1640324_at:166:177; Interrogation_Position=1244; Antisense; AAACGCTTAGTATTTTCCCTCTGTG
>probe:Drosophila_2:1640324_at:460:91; Interrogation_Position=1252; Antisense; AGTATTTTCCCTCTGTGCAATAACG

Paste this into a BLAST search page for me
GATCAAGGAGGATGCCGAGACCGATATGCCGAGACCGATATTGGATACGTATATTGGATACGTCCTGGTCACTCTTGGTCACTCTTACGGCTTGGTAGACCTTGGTAGACGGAAGCAGCCGGAATGCCGGAATATCCGAATATCTATGAGTATCTATGAGCAATACCCCACTGTTAGCAATACCCCACTGTTCAAGTAGACAAATGGAGTTGGTCTATATACAGTATACAGTAGTTGTGATGTGTTCTAAGATGTGTTCTAAAAATCCAATCTACAAATCCAATCTACAAAACGCTTAGTAAACGCTTAGTATTTTCCCTCTGTGAGTATTTTCCCTCTGTGCAATAACG

Full Affymetrix probeset data:

Annotations for 1640324_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720