Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640325_at:

>probe:Drosophila_2:1640325_at:330:443; Interrogation_Position=1003; Antisense; GATGACCTATTCCACTCGCTGTTTA
>probe:Drosophila_2:1640325_at:35:37; Interrogation_Position=1064; Antisense; ATCATCGTCGATTGGTCTCCGTTTT
>probe:Drosophila_2:1640325_at:184:109; Interrogation_Position=1139; Antisense; AGAAGAATGCCCTGTCCATCAAGAG
>probe:Drosophila_2:1640325_at:216:47; Interrogation_Position=1216; Antisense; ATCCGCACCGATCTCAATCTGATGA
>probe:Drosophila_2:1640325_at:457:427; Interrogation_Position=1239; Antisense; GAGATCCAAGACGATGGCGCTCAAT
>probe:Drosophila_2:1640325_at:223:549; Interrogation_Position=1280; Antisense; GGAGTCCTTCGCGTTGGAACCGCTG
>probe:Drosophila_2:1640325_at:625:711; Interrogation_Position=733; Antisense; TTCATCCTCGTCTTCAGCATGGATT
>probe:Drosophila_2:1640325_at:52:543; Interrogation_Position=753; Antisense; GGATTCCCGCGAGTCCTTCGAGGAG
>probe:Drosophila_2:1640325_at:673:717; Interrogation_Position=782; Antisense; TTCGCCTGCGGGAGAACATTCTGGA
>probe:Drosophila_2:1640325_at:52:221; Interrogation_Position=811; Antisense; AAGTGGGCTGCACTAAATCCCGGCT
>probe:Drosophila_2:1640325_at:37:595; Interrogation_Position=932; Antisense; TGGGCTACATCGCTGGCCAGGACAA
>probe:Drosophila_2:1640325_at:726:397; Interrogation_Position=952; Antisense; GACAACTGCTGCACCTTTGTGGAGT
>probe:Drosophila_2:1640325_at:542:549; Interrogation_Position=972; Antisense; GGAGTGCTCGGCTCGTCAGAATTAC
>probe:Drosophila_2:1640325_at:556:109; Interrogation_Position=989; Antisense; AGAATTACCGCATCGATGACCTATT

Paste this into a BLAST search page for me
GATGACCTATTCCACTCGCTGTTTAATCATCGTCGATTGGTCTCCGTTTTAGAAGAATGCCCTGTCCATCAAGAGATCCGCACCGATCTCAATCTGATGAGAGATCCAAGACGATGGCGCTCAATGGAGTCCTTCGCGTTGGAACCGCTGTTCATCCTCGTCTTCAGCATGGATTGGATTCCCGCGAGTCCTTCGAGGAGTTCGCCTGCGGGAGAACATTCTGGAAAGTGGGCTGCACTAAATCCCGGCTTGGGCTACATCGCTGGCCAGGACAAGACAACTGCTGCACCTTTGTGGAGTGGAGTGCTCGGCTCGTCAGAATTACAGAATTACCGCATCGATGACCTATT

Full Affymetrix probeset data:

Annotations for 1640325_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime