FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640326_at:

>probe:Drosophila_2:1640326_at:455:357; Interrogation_Position=108; Antisense; GCACAGACGAACTGGATGACCTGCA
>probe:Drosophila_2:1640326_at:72:587; Interrogation_Position=120; Antisense; TGGATGACCTGCAGCGTTTGAAGAG
>probe:Drosophila_2:1640326_at:590:49; Interrogation_Position=150; Antisense; ATGCCATCTATCCTAAGTTCGTCAA
>probe:Drosophila_2:1640326_at:392:127; Interrogation_Position=16; Antisense; CCTTAATTACCGTCTGCGGTTCGAT
>probe:Drosophila_2:1640326_at:586:471; Interrogation_Position=166; Antisense; GTTCGTCAACATTGAAGTAGCCACG
>probe:Drosophila_2:1640326_at:129:215; Interrogation_Position=180; Antisense; AAGTAGCCACGGAACGGGCGCAGCC
>probe:Drosophila_2:1640326_at:459:709; Interrogation_Position=206; Antisense; TTCTCCGTTTTACTGCGCGGTACAC
>probe:Drosophila_2:1640326_at:48:625; Interrogation_Position=219; Antisense; TGCGCGGTACACCAAAGATTACGGA
>probe:Drosophila_2:1640326_at:534:95; Interrogation_Position=234; Antisense; AGATTACGGAATCGCTGGCTCTGCC
>probe:Drosophila_2:1640326_at:648:581; Interrogation_Position=249; Antisense; TGGCTCTGCCCGTGCATTTTCGCTA
>probe:Drosophila_2:1640326_at:501:289; Interrogation_Position=32; Antisense; CGGTTCGATATACCCTTGGTGGGCA
>probe:Drosophila_2:1640326_at:252:251; Interrogation_Position=55; Antisense; CAAGGACTGCGAGTATGCGCTGGTC
>probe:Drosophila_2:1640326_at:549:683; Interrogation_Position=68; Antisense; TATGCGCTGGTCCAGGATTTGCCCG
>probe:Drosophila_2:1640326_at:479:17; Interrogation_Position=84; Antisense; ATTTGCCCGCATCCGTTTACATAAG

Paste this into a BLAST search page for me
GCACAGACGAACTGGATGACCTGCATGGATGACCTGCAGCGTTTGAAGAGATGCCATCTATCCTAAGTTCGTCAACCTTAATTACCGTCTGCGGTTCGATGTTCGTCAACATTGAAGTAGCCACGAAGTAGCCACGGAACGGGCGCAGCCTTCTCCGTTTTACTGCGCGGTACACTGCGCGGTACACCAAAGATTACGGAAGATTACGGAATCGCTGGCTCTGCCTGGCTCTGCCCGTGCATTTTCGCTACGGTTCGATATACCCTTGGTGGGCACAAGGACTGCGAGTATGCGCTGGTCTATGCGCTGGTCCAGGATTTGCCCGATTTGCCCGCATCCGTTTACATAAG

Full Affymetrix probeset data:

Annotations for 1640326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720