FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640327_at:

>probe:Drosophila_2:1640327_at:605:119; Interrogation_Position=1030; Antisense; AGCTGTATCAGTAATCCGCTGGACA
>probe:Drosophila_2:1640327_at:2:413; Interrogation_Position=1111; Antisense; GACCCACTGCAATCTCAAGCTAATA
>probe:Drosophila_2:1640327_at:353:23; Interrogation_Position=1133; Antisense; ATAGGCTATGCCCACGAGTATCCAG
>probe:Drosophila_2:1640327_at:29:431; Interrogation_Position=1148; Antisense; GAGTATCCAGATCCGTATTCGTCTA
>probe:Drosophila_2:1640327_at:578:645; Interrogation_Position=1183; Antisense; TCATCTGCCTTAGACCCTATTATTT
>probe:Drosophila_2:1640327_at:578:301; Interrogation_Position=1226; Antisense; CCCATTGCCCTCATACGTATTTATA
>probe:Drosophila_2:1640327_at:677:23; Interrogation_Position=1248; Antisense; ATATCGCCTTTGCATCCTATTTATA
>probe:Drosophila_2:1640327_at:607:729; Interrogation_Position=811; Antisense; TTGTGTTCGATCACCAGTCCTGGAA
>probe:Drosophila_2:1640327_at:140:563; Interrogation_Position=832; Antisense; GGAACTGCTACTTCAATAACTTCGT
>probe:Drosophila_2:1640327_at:535:31; Interrogation_Position=847; Antisense; ATAACTTCGTGCATTTCTTCCATCA
>probe:Drosophila_2:1640327_at:79:35; Interrogation_Position=868; Antisense; ATCACAACATGCACGAGGCTCTCAA
>probe:Drosophila_2:1640327_at:367:653; Interrogation_Position=904; Antisense; TCAACGATGCCTGCAATCCGAGGAA
>probe:Drosophila_2:1640327_at:361:381; Interrogation_Position=926; Antisense; GAACGCCGAGTACAATGCCGATCAC
>probe:Drosophila_2:1640327_at:493:625; Interrogation_Position=941; Antisense; TGCCGATCACATATGGCCGATGTTT

Paste this into a BLAST search page for me
AGCTGTATCAGTAATCCGCTGGACAGACCCACTGCAATCTCAAGCTAATAATAGGCTATGCCCACGAGTATCCAGGAGTATCCAGATCCGTATTCGTCTATCATCTGCCTTAGACCCTATTATTTCCCATTGCCCTCATACGTATTTATAATATCGCCTTTGCATCCTATTTATATTGTGTTCGATCACCAGTCCTGGAAGGAACTGCTACTTCAATAACTTCGTATAACTTCGTGCATTTCTTCCATCAATCACAACATGCACGAGGCTCTCAATCAACGATGCCTGCAATCCGAGGAAGAACGCCGAGTACAATGCCGATCACTGCCGATCACATATGGCCGATGTTT

Full Affymetrix probeset data:

Annotations for 1640327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720