Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640330_at:

>probe:Drosophila_2:1640330_at:280:249; Interrogation_Position=1032; Antisense; CAATATTATCGTGTGGAGCTCTGCT
>probe:Drosophila_2:1640330_at:692:417; Interrogation_Position=1047; Antisense; GAGCTCTGCTGGACTTTTAACGTGC
>probe:Drosophila_2:1640330_at:290:455; Interrogation_Position=1111; Antisense; GATAACCCGTATAATCCTGCAGTAG
>probe:Drosophila_2:1640330_at:669:545; Interrogation_Position=1165; Antisense; GGATGGTCCGCAACGTTTTATTTCT
>probe:Drosophila_2:1640330_at:109:321; Interrogation_Position=1192; Antisense; GCCCCACTGGCAATCCTAATAATTT
>probe:Drosophila_2:1640330_at:411:253; Interrogation_Position=1241; Antisense; CAACCCGATATATTTACGTGGAGAA
>probe:Drosophila_2:1640330_at:193:119; Interrogation_Position=1294; Antisense; AGCGAACCGCAAAAGCTTTCCAGGA
>probe:Drosophila_2:1640330_at:647:629; Interrogation_Position=1312; Antisense; TCCAGGAACCATGCCAACTATCGAA
>probe:Drosophila_2:1640330_at:218:635; Interrogation_Position=1358; Antisense; TAATGGGCGGAAGTTGGTTTCTCGA
>probe:Drosophila_2:1640330_at:119:541; Interrogation_Position=1373; Antisense; GGTTTCTCGAAATTATTGCCTTTAT
>probe:Drosophila_2:1640330_at:221:437; Interrogation_Position=1404; Antisense; GATGGAGAATATGTGGAAGCCCTTA
>probe:Drosophila_2:1640330_at:361:599; Interrogation_Position=1476; Antisense; TGTAGCTACATTCTGCAACCACGAA
>probe:Drosophila_2:1640330_at:635:251; Interrogation_Position=1518; Antisense; CAAGCGGTGGGTTTTCTGTGACAGT
>probe:Drosophila_2:1640330_at:379:391; Interrogation_Position=983; Antisense; GAAAGTTCCAGGTCTTCTACAAGAA

Paste this into a BLAST search page for me
CAATATTATCGTGTGGAGCTCTGCTGAGCTCTGCTGGACTTTTAACGTGCGATAACCCGTATAATCCTGCAGTAGGGATGGTCCGCAACGTTTTATTTCTGCCCCACTGGCAATCCTAATAATTTCAACCCGATATATTTACGTGGAGAAAGCGAACCGCAAAAGCTTTCCAGGATCCAGGAACCATGCCAACTATCGAATAATGGGCGGAAGTTGGTTTCTCGAGGTTTCTCGAAATTATTGCCTTTATGATGGAGAATATGTGGAAGCCCTTATGTAGCTACATTCTGCAACCACGAACAAGCGGTGGGTTTTCTGTGACAGTGAAAGTTCCAGGTCTTCTACAAGAA

Full Affymetrix probeset data:

Annotations for 1640330_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime