FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640332_at:

>probe:Drosophila_2:1640332_at:702:7; Interrogation_Position=1062; Antisense; ATTCCTCGAGGTCTCGCAAGACGTA
>probe:Drosophila_2:1640332_at:659:359; Interrogation_Position=1077; Antisense; GCAAGACGTACCGATGATCATTCAA
>probe:Drosophila_2:1640332_at:162:347; Interrogation_Position=1113; Antisense; GCATCCAAAACAATTCGCCGGCAAG
>probe:Drosophila_2:1640332_at:120:173; Interrogation_Position=1161; Antisense; AAAGATCATTAGTCGCAAGGTGCCC
>probe:Drosophila_2:1640332_at:428:251; Interrogation_Position=1176; Antisense; CAAGGTGCCCGCCTAAAGGGAGATT
>probe:Drosophila_2:1640332_at:588:9; Interrogation_Position=1260; Antisense; ATTCTAGACCCTCACTTTTGTAAAG
>probe:Drosophila_2:1640332_at:202:67; Interrogation_Position=740; Antisense; AGGCCTGGGCCATGTTTATGTGCAA
>probe:Drosophila_2:1640332_at:39:239; Interrogation_Position=763; Antisense; AATCTCTTTGAGAACCTGGGTCCCT
>probe:Drosophila_2:1640332_at:70:503; Interrogation_Position=782; Antisense; GTCCCTCCGAATGGCTGTTGTACAT
>probe:Drosophila_2:1640332_at:684:493; Interrogation_Position=827; Antisense; GTCAGACCATCTCCAACATACGAGT
>probe:Drosophila_2:1640332_at:346:249; Interrogation_Position=885; Antisense; CAATTGCCCGCAGCTGAAAAATATT
>probe:Drosophila_2:1640332_at:460:567; Interrogation_Position=910; Antisense; GGCAGCATGATCCTGTACAACATTG
>probe:Drosophila_2:1640332_at:333:519; Interrogation_Position=955; Antisense; GTGGTATTCGACGATATCGCCGTGG
>probe:Drosophila_2:1640332_at:150:581; Interrogation_Position=989; Antisense; TGGCCATTCTTCAGTTCTTCCAGAG

Paste this into a BLAST search page for me
ATTCCTCGAGGTCTCGCAAGACGTAGCAAGACGTACCGATGATCATTCAAGCATCCAAAACAATTCGCCGGCAAGAAAGATCATTAGTCGCAAGGTGCCCCAAGGTGCCCGCCTAAAGGGAGATTATTCTAGACCCTCACTTTTGTAAAGAGGCCTGGGCCATGTTTATGTGCAAAATCTCTTTGAGAACCTGGGTCCCTGTCCCTCCGAATGGCTGTTGTACATGTCAGACCATCTCCAACATACGAGTCAATTGCCCGCAGCTGAAAAATATTGGCAGCATGATCCTGTACAACATTGGTGGTATTCGACGATATCGCCGTGGTGGCCATTCTTCAGTTCTTCCAGAG

Full Affymetrix probeset data:

Annotations for 1640332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720