FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640333_at:

>probe:Drosophila_2:1640333_at:718:395; Interrogation_Position=1560; Antisense; GACAGATTCCTTACGGGAGTTTTGC
>probe:Drosophila_2:1640333_at:589:429; Interrogation_Position=1576; Antisense; GAGTTTTGCCGAAGACATCGCACCT
>probe:Drosophila_2:1640333_at:306:569; Interrogation_Position=1632; Antisense; GGCAGACTTTGTACCGCGTAGTCAA
>probe:Drosophila_2:1640333_at:296:105; Interrogation_Position=1690; Antisense; AGACATCAGCTGACGGGCGAAACCT
>probe:Drosophila_2:1640333_at:225:503; Interrogation_Position=1726; Antisense; GTCCCGCGAATGATTACTGTGCAGA
>probe:Drosophila_2:1640333_at:431:117; Interrogation_Position=1802; Antisense; AGCTTTGCTACGTTGATGCGTTGCA
>probe:Drosophila_2:1640333_at:694:467; Interrogation_Position=1821; Antisense; GTTGCATCCGGATCTTGTGGTACCA
>probe:Drosophila_2:1640333_at:691:177; Interrogation_Position=1862; Antisense; AAACACTGGACTTTTATTCTGTACA
>probe:Drosophila_2:1640333_at:455:153; Interrogation_Position=1897; Antisense; ACAGTTTTGGTTCAATAGCGGCCAG
>probe:Drosophila_2:1640333_at:713:673; Interrogation_Position=1912; Antisense; TAGCGGCCAGTATAATAGCACGGAC
>probe:Drosophila_2:1640333_at:80:273; Interrogation_Position=1936; Antisense; CTTTGCACCATTCTCCGTATTTAGA
>probe:Drosophila_2:1640333_at:99:723; Interrogation_Position=1998; Antisense; TTGTTCGATTTTACTTCTGTCTCCC
>probe:Drosophila_2:1640333_at:671:285; Interrogation_Position=2014; Antisense; CTGTCTCCCTCTGTTTTAAAGTGCA
>probe:Drosophila_2:1640333_at:67:19; Interrogation_Position=2070; Antisense; ATTTCACTAAGCAATTCCACTCAGA

Paste this into a BLAST search page for me
GACAGATTCCTTACGGGAGTTTTGCGAGTTTTGCCGAAGACATCGCACCTGGCAGACTTTGTACCGCGTAGTCAAAGACATCAGCTGACGGGCGAAACCTGTCCCGCGAATGATTACTGTGCAGAAGCTTTGCTACGTTGATGCGTTGCAGTTGCATCCGGATCTTGTGGTACCAAAACACTGGACTTTTATTCTGTACAACAGTTTTGGTTCAATAGCGGCCAGTAGCGGCCAGTATAATAGCACGGACCTTTGCACCATTCTCCGTATTTAGATTGTTCGATTTTACTTCTGTCTCCCCTGTCTCCCTCTGTTTTAAAGTGCAATTTCACTAAGCAATTCCACTCAGA

Full Affymetrix probeset data:

Annotations for 1640333_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720