FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640334_at:

>probe:Drosophila_2:1640334_at:396:305; Interrogation_Position=106; Antisense; CCGGCGATATGTTTACCCTGGAGAA
>probe:Drosophila_2:1640334_at:28:589; Interrogation_Position=124; Antisense; TGGAGAATCCTGTCTTTTGCTGCTA
>probe:Drosophila_2:1640334_at:548:723; Interrogation_Position=140; Antisense; TTGCTGCTATCTTTTTTGGTCCACA
>probe:Drosophila_2:1640334_at:136:591; Interrogation_Position=172; Antisense; TGGTGAAGATGCTGCTCATGTCGCT
>probe:Drosophila_2:1640334_at:644:655; Interrogation_Position=224; Antisense; TAAGATCTTTCCCAACCAGGAGGAT
>probe:Drosophila_2:1640334_at:701:645; Interrogation_Position=301; Antisense; TCAGAAGGGCCCATCGCAATGACAT
>probe:Drosophila_2:1640334_at:532:641; Interrogation_Position=335; Antisense; TCTGCCGTATTTTATCATGTCCTTG
>probe:Drosophila_2:1640334_at:698:63; Interrogation_Position=388; Antisense; ATGTGGCCTGCATACTGTTCCGAGT
>probe:Drosophila_2:1640334_at:224:77; Interrogation_Position=426; Antisense; AGGATCATACACACTCTGGTTTACG
>probe:Drosophila_2:1640334_at:209:507; Interrogation_Position=462; Antisense; GTGCCGCAGCCATCGAGGATTCTAG
>probe:Drosophila_2:1640334_at:621:51; Interrogation_Position=498; Antisense; ATGCTACTGATCACCTTCTACATGG
>probe:Drosophila_2:1640334_at:103:307; Interrogation_Position=536; Antisense; CCTGCGTACCCTAAGCTTTATATGA
>probe:Drosophila_2:1640334_at:600:61; Interrogation_Position=63; Antisense; ATGTCGGCCGCAGCTAGTAATTCCA
>probe:Drosophila_2:1640334_at:113:215; Interrogation_Position=90; Antisense; AAGATGATGACATCGCCCGGCGATA

Paste this into a BLAST search page for me
CCGGCGATATGTTTACCCTGGAGAATGGAGAATCCTGTCTTTTGCTGCTATTGCTGCTATCTTTTTTGGTCCACATGGTGAAGATGCTGCTCATGTCGCTTAAGATCTTTCCCAACCAGGAGGATTCAGAAGGGCCCATCGCAATGACATTCTGCCGTATTTTATCATGTCCTTGATGTGGCCTGCATACTGTTCCGAGTAGGATCATACACACTCTGGTTTACGGTGCCGCAGCCATCGAGGATTCTAGATGCTACTGATCACCTTCTACATGGCCTGCGTACCCTAAGCTTTATATGAATGTCGGCCGCAGCTAGTAATTCCAAAGATGATGACATCGCCCGGCGATA

Full Affymetrix probeset data:

Annotations for 1640334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720