FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640336_at:

>probe:Drosophila_2:1640336_at:664:599; Interrogation_Position=1009; Antisense; TGTAGTTACATTTTTGGTTCACCCT
>probe:Drosophila_2:1640336_at:651:657; Interrogation_Position=1033; Antisense; TAAGGTTCATTACCCGCACACAAAC
>probe:Drosophila_2:1640336_at:415:241; Interrogation_Position=1086; Antisense; AATACATATGCGTTTATCCCACACC
>probe:Drosophila_2:1640336_at:53:117; Interrogation_Position=582; Antisense; AGCTACGAACTCTTCCAGGGCATTG
>probe:Drosophila_2:1640336_at:433:3; Interrogation_Position=614; Antisense; ATTGGAGTCGGTTAGCTTCACGGGC
>probe:Drosophila_2:1640336_at:75:711; Interrogation_Position=630; Antisense; TTCACGGGCTTGAAGGACCGCATAC
>probe:Drosophila_2:1640336_at:40:1; Interrogation_Position=651; Antisense; ATACGGGACCTGCACCTAAACGAAT
>probe:Drosophila_2:1640336_at:361:99; Interrogation_Position=715; Antisense; AGATGATGTTCGACCAGCGTTTCCT
>probe:Drosophila_2:1640336_at:158:123; Interrogation_Position=730; Antisense; AGCGTTTCCTGCAAAATCGCCTGGA
>probe:Drosophila_2:1640336_at:382:363; Interrogation_Position=801; Antisense; GAATTCGGCGACATACCCGAGCTGA
>probe:Drosophila_2:1640336_at:454:269; Interrogation_Position=841; Antisense; CATGCACTCAGTTGGAACGCGGACT
>probe:Drosophila_2:1640336_at:723:107; Interrogation_Position=907; Antisense; AGAAGCGTCTGTGCTGGGCCACCGA
>probe:Drosophila_2:1640336_at:521:227; Interrogation_Position=963; Antisense; AATGCGGTTGGCTCGGATCCGGAAA
>probe:Drosophila_2:1640336_at:205:107; Interrogation_Position=988; Antisense; AGAACTTCTGAATTGGTGACCTGTA

Paste this into a BLAST search page for me
TGTAGTTACATTTTTGGTTCACCCTTAAGGTTCATTACCCGCACACAAACAATACATATGCGTTTATCCCACACCAGCTACGAACTCTTCCAGGGCATTGATTGGAGTCGGTTAGCTTCACGGGCTTCACGGGCTTGAAGGACCGCATACATACGGGACCTGCACCTAAACGAATAGATGATGTTCGACCAGCGTTTCCTAGCGTTTCCTGCAAAATCGCCTGGAGAATTCGGCGACATACCCGAGCTGACATGCACTCAGTTGGAACGCGGACTAGAAGCGTCTGTGCTGGGCCACCGAAATGCGGTTGGCTCGGATCCGGAAAAGAACTTCTGAATTGGTGACCTGTA

Full Affymetrix probeset data:

Annotations for 1640336_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720