FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640339_at:

>probe:Drosophila_2:1640339_at:441:535; Interrogation_Position=197; Antisense; GGTGCTACGCATCAAGACGCTTCTG
>probe:Drosophila_2:1640339_at:657:397; Interrogation_Position=225; Antisense; GACAAGCCGGACATGGTTGGCCTAA
>probe:Drosophila_2:1640339_at:659:545; Interrogation_Position=270; Antisense; GGATGCAATGGTCTGTCCTACACGC
>probe:Drosophila_2:1640339_at:253:505; Interrogation_Position=336; Antisense; GTCCAGGATGGCGTCAAGGTCTTCA
>probe:Drosophila_2:1640339_at:644:173; Interrogation_Position=369; Antisense; AAAGCGCAGTTGTCGCTGCTGGGTA
>probe:Drosophila_2:1640339_at:680:119; Interrogation_Position=418; Antisense; AGCTGTCCAGCGAGTTCGTGTTTAA
>probe:Drosophila_2:1640339_at:310:283; Interrogation_Position=470; Antisense; CTGCGGCGAATCGTTCAGCATGTAA
>probe:Drosophila_2:1640339_at:478:299; Interrogation_Position=529; Antisense; CGCCTCGCAGACAGACCTAAATTAA
>probe:Drosophila_2:1640339_at:359:91; Interrogation_Position=557; Antisense; AGTTAAATGCAGTACGCGGCCCGAC
>probe:Drosophila_2:1640339_at:629:301; Interrogation_Position=577; Antisense; CCGACCTTGTATCTCATTACGTTGT
>probe:Drosophila_2:1640339_at:497:671; Interrogation_Position=594; Antisense; TACGTTGTTGGCAAAAGCACCGCAT
>probe:Drosophila_2:1640339_at:445:113; Interrogation_Position=609; Antisense; AGCACCGCATCCTTTGTAAATTTTA
>probe:Drosophila_2:1640339_at:204:349; Interrogation_Position=723; Antisense; GCAGGCTGGCAGTTTGTCCTCTTTA
>probe:Drosophila_2:1640339_at:468:723; Interrogation_Position=736; Antisense; TTGTCCTCTTTAGCCCTAGTTCAAT

Paste this into a BLAST search page for me
GGTGCTACGCATCAAGACGCTTCTGGACAAGCCGGACATGGTTGGCCTAAGGATGCAATGGTCTGTCCTACACGCGTCCAGGATGGCGTCAAGGTCTTCAAAAGCGCAGTTGTCGCTGCTGGGTAAGCTGTCCAGCGAGTTCGTGTTTAACTGCGGCGAATCGTTCAGCATGTAACGCCTCGCAGACAGACCTAAATTAAAGTTAAATGCAGTACGCGGCCCGACCCGACCTTGTATCTCATTACGTTGTTACGTTGTTGGCAAAAGCACCGCATAGCACCGCATCCTTTGTAAATTTTAGCAGGCTGGCAGTTTGTCCTCTTTATTGTCCTCTTTAGCCCTAGTTCAAT

Full Affymetrix probeset data:

Annotations for 1640339_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720