Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640342_at:

>probe:Drosophila_2:1640342_at:474:155; Interrogation_Position=1941; Antisense; ACAGCAGTGATCTTCATCGTGGCCT
>probe:Drosophila_2:1640342_at:261:537; Interrogation_Position=1970; Antisense; GGTCATCTTCGTGGTTTCCTTCCAA
>probe:Drosophila_2:1640342_at:5:113; Interrogation_Position=1999; Antisense; AGCACGGCACCTTGGACATTGAGAT
>probe:Drosophila_2:1640342_at:94:615; Interrogation_Position=2074; Antisense; TGAAGCTGCTCGATGTGGATCTCTC
>probe:Drosophila_2:1640342_at:690:493; Interrogation_Position=2106; Antisense; GTCATTCTGCCGATGGGCAACGAGG
>probe:Drosophila_2:1640342_at:354:551; Interrogation_Position=2129; Antisense; GGAGACCGATGAATGCCTGTAGACT
>probe:Drosophila_2:1640342_at:89:601; Interrogation_Position=2146; Antisense; TGTAGACTCTCTCAGCACGATGATG
>probe:Drosophila_2:1640342_at:686:137; Interrogation_Position=2162; Antisense; ACGATGATGCCAACACCATGGTGCC
>probe:Drosophila_2:1640342_at:104:307; Interrogation_Position=2177; Antisense; CCATGGTGCCCTGTAAATATTTATT
>probe:Drosophila_2:1640342_at:226:177; Interrogation_Position=2222; Antisense; AAACTTCAGGCTGTTTCTTTGGCCG
>probe:Drosophila_2:1640342_at:421:577; Interrogation_Position=2242; Antisense; GGCCGGATGTTCATTTTGGTTACTA
>probe:Drosophila_2:1640342_at:518:463; Interrogation_Position=2271; Antisense; GTTGACTGAGAGCAGCTGCAAGCTA
>probe:Drosophila_2:1640342_at:725:391; Interrogation_Position=2321; Antisense; GAAAGCATTTGCCATACTGTTTAAT
>probe:Drosophila_2:1640342_at:9:475; Interrogation_Position=2417; Antisense; GTTAAGCTCTTTTTTATTGTGTCTG

Paste this into a BLAST search page for me
ACAGCAGTGATCTTCATCGTGGCCTGGTCATCTTCGTGGTTTCCTTCCAAAGCACGGCACCTTGGACATTGAGATTGAAGCTGCTCGATGTGGATCTCTCGTCATTCTGCCGATGGGCAACGAGGGGAGACCGATGAATGCCTGTAGACTTGTAGACTCTCTCAGCACGATGATGACGATGATGCCAACACCATGGTGCCCCATGGTGCCCTGTAAATATTTATTAAACTTCAGGCTGTTTCTTTGGCCGGGCCGGATGTTCATTTTGGTTACTAGTTGACTGAGAGCAGCTGCAAGCTAGAAAGCATTTGCCATACTGTTTAATGTTAAGCTCTTTTTTATTGTGTCTG

Full Affymetrix probeset data:

Annotations for 1640342_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime