FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640343_at:

>probe:Drosophila_2:1640343_at:91:233; Interrogation_Position=525; Antisense; AATGCACAATGCACCGGCCGTTAGC
>probe:Drosophila_2:1640343_at:131:675; Interrogation_Position=546; Antisense; TAGCTAACACGTTCGGCATTTTGCC
>probe:Drosophila_2:1640343_at:218:249; Interrogation_Position=593; Antisense; AATTGTGTCTCTTCCAGCCGAAAAC
>probe:Drosophila_2:1640343_at:22:607; Interrogation_Position=622; Antisense; TGATGAGGCATCGATCTGCTCGCAA
>probe:Drosophila_2:1640343_at:58:647; Interrogation_Position=651; Antisense; TCAAGGCAAGTTCTCCAAGGGTCCG
>probe:Drosophila_2:1640343_at:245:311; Interrogation_Position=675; Antisense; GCCAAATGGACATTCCCGAGGTGGT
>probe:Drosophila_2:1640343_at:469:547; Interrogation_Position=700; Antisense; GGATGTTAACCCAGACGATATACTA
>probe:Drosophila_2:1640343_at:106:459; Interrogation_Position=716; Antisense; GATATACTAAGCTTACACTCGCAAG
>probe:Drosophila_2:1640343_at:552:635; Interrogation_Position=734; Antisense; TCGCAAGAGTCCTGTGCAGAGCTAC
>probe:Drosophila_2:1640343_at:680:437; Interrogation_Position=827; Antisense; GAGGAATCCCAACCTATTCTGCTAA
>probe:Drosophila_2:1640343_at:153:623; Interrogation_Position=910; Antisense; TGCGGAATACAACCGATTGCCACTT
>probe:Drosophila_2:1640343_at:440:463; Interrogation_Position=924; Antisense; GATTGCCACTTACCGTGGGCACATT
>probe:Drosophila_2:1640343_at:660:593; Interrogation_Position=939; Antisense; TGGGCACATTGCGAGTCCGGAATCT
>probe:Drosophila_2:1640343_at:441:727; Interrogation_Position=995; Antisense; TTGGACTACGATCTCAGCAGGCTAT

Paste this into a BLAST search page for me
AATGCACAATGCACCGGCCGTTAGCTAGCTAACACGTTCGGCATTTTGCCAATTGTGTCTCTTCCAGCCGAAAACTGATGAGGCATCGATCTGCTCGCAATCAAGGCAAGTTCTCCAAGGGTCCGGCCAAATGGACATTCCCGAGGTGGTGGATGTTAACCCAGACGATATACTAGATATACTAAGCTTACACTCGCAAGTCGCAAGAGTCCTGTGCAGAGCTACGAGGAATCCCAACCTATTCTGCTAATGCGGAATACAACCGATTGCCACTTGATTGCCACTTACCGTGGGCACATTTGGGCACATTGCGAGTCCGGAATCTTTGGACTACGATCTCAGCAGGCTAT

Full Affymetrix probeset data:

Annotations for 1640343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720