FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640344_at:

>probe:Drosophila_2:1640344_at:462:493; Interrogation_Position=1820; Antisense; GTAATCTAAGTTATCGCTCTTCTCG
>probe:Drosophila_2:1640344_at:144:339; Interrogation_Position=1835; Antisense; GCTCTTCTCGACCTCAATTATTTAC
>probe:Drosophila_2:1640344_at:618:253; Interrogation_Position=1941; Antisense; CAACATCAACTATCGCAGTCGTCAT
>probe:Drosophila_2:1640344_at:137:351; Interrogation_Position=1955; Antisense; GCAGTCGTCATAGCTGTTTACTAAA
>probe:Drosophila_2:1640344_at:64:499; Interrogation_Position=1994; Antisense; GTCTACTTCATGCACTTTTTATTGG
>probe:Drosophila_2:1640344_at:22:491; Interrogation_Position=2074; Antisense; GTACAACATGTAATGCACTTAGCCC
>probe:Drosophila_2:1640344_at:477:177; Interrogation_Position=2101; Antisense; AAACGATATTTTAGAGAGCCCACAA
>probe:Drosophila_2:1640344_at:299:425; Interrogation_Position=2114; Antisense; GAGAGCCCACAACATGGCGGCCAAA
>probe:Drosophila_2:1640344_at:406:571; Interrogation_Position=2129; Antisense; GGCGGCCAAAATGCCCTTGAAAACT
>probe:Drosophila_2:1640344_at:13:389; Interrogation_Position=2147; Antisense; GAAAACTTCAATGTTTCCTCATTCT
>probe:Drosophila_2:1640344_at:112:695; Interrogation_Position=2160; Antisense; TTTCCTCATTCTCATTTTACACACA
>probe:Drosophila_2:1640344_at:663:525; Interrogation_Position=2198; Antisense; GGGAATTCCAGCATTTTTGCTTCTC
>probe:Drosophila_2:1640344_at:577:341; Interrogation_Position=2208; Antisense; GCATTTTTGCTTCTCGTTTTGGATA
>probe:Drosophila_2:1640344_at:12:211; Interrogation_Position=2247; Antisense; AAGACTTGGACTTGCAGCTGCAACA

Paste this into a BLAST search page for me
GTAATCTAAGTTATCGCTCTTCTCGGCTCTTCTCGACCTCAATTATTTACCAACATCAACTATCGCAGTCGTCATGCAGTCGTCATAGCTGTTTACTAAAGTCTACTTCATGCACTTTTTATTGGGTACAACATGTAATGCACTTAGCCCAAACGATATTTTAGAGAGCCCACAAGAGAGCCCACAACATGGCGGCCAAAGGCGGCCAAAATGCCCTTGAAAACTGAAAACTTCAATGTTTCCTCATTCTTTTCCTCATTCTCATTTTACACACAGGGAATTCCAGCATTTTTGCTTCTCGCATTTTTGCTTCTCGTTTTGGATAAAGACTTGGACTTGCAGCTGCAACA

Full Affymetrix probeset data:

Annotations for 1640344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720