FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640345_at:

>probe:Drosophila_2:1640345_at:74:117; Interrogation_Position=328; Antisense; AGCATATTGGGCTCCCTGACGGATG
>probe:Drosophila_2:1640345_at:696:407; Interrogation_Position=345; Antisense; GACGGATGCCCGTCAATTTGGCAAC
>probe:Drosophila_2:1640345_at:295:19; Interrogation_Position=360; Antisense; ATTTGGCAACCTGTCACCCATCGAT
>probe:Drosophila_2:1640345_at:231:607; Interrogation_Position=413; Antisense; TGATGCGGACGCACACGCTCAAAAT
>probe:Drosophila_2:1640345_at:164:651; Interrogation_Position=516; Antisense; TCACATCAAGTACGTGGTGGCCGCC
>probe:Drosophila_2:1640345_at:407:347; Interrogation_Position=557; Antisense; GCATCGCTGGTCCATTGGGTCTGAA
>probe:Drosophila_2:1640345_at:35:275; Interrogation_Position=569; Antisense; CATTGGGTCTGAAGGCTCTGGCCGC
>probe:Drosophila_2:1640345_at:680:359; Interrogation_Position=602; Antisense; GCAAGGCTCTGGTCATCAGCAAGGT
>probe:Drosophila_2:1640345_at:355:223; Interrogation_Position=622; Antisense; AAGGTGGCCCTGACCATTGCCGGGA
>probe:Drosophila_2:1640345_at:321:9; Interrogation_Position=637; Antisense; ATTGCCGGGATCATTGCGCTCAAGA
>probe:Drosophila_2:1640345_at:655:155; Interrogation_Position=680; Antisense; ACAGCGAGGAGACCAGCTTCCAGGT
>probe:Drosophila_2:1640345_at:317:79; Interrogation_Position=701; Antisense; AGGTGCACGCCGGTGAACATAACAG
>probe:Drosophila_2:1640345_at:167:605; Interrogation_Position=740; Antisense; TGATCCGGCCGGTGTCCAAGACGAG
>probe:Drosophila_2:1640345_at:518:531; Interrogation_Position=819; Antisense; GGTGGATCCGTATCGCTACTACTAT

Paste this into a BLAST search page for me
AGCATATTGGGCTCCCTGACGGATGGACGGATGCCCGTCAATTTGGCAACATTTGGCAACCTGTCACCCATCGATTGATGCGGACGCACACGCTCAAAATTCACATCAAGTACGTGGTGGCCGCCGCATCGCTGGTCCATTGGGTCTGAACATTGGGTCTGAAGGCTCTGGCCGCGCAAGGCTCTGGTCATCAGCAAGGTAAGGTGGCCCTGACCATTGCCGGGAATTGCCGGGATCATTGCGCTCAAGAACAGCGAGGAGACCAGCTTCCAGGTAGGTGCACGCCGGTGAACATAACAGTGATCCGGCCGGTGTCCAAGACGAGGGTGGATCCGTATCGCTACTACTAT

Full Affymetrix probeset data:

Annotations for 1640345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720