FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640346_at:

>probe:Drosophila_2:1640346_at:134:63; Interrogation_Position=1016; Antisense; ATGTGATGATCTACTACTGCGTGGA
>probe:Drosophila_2:1640346_at:625:541; Interrogation_Position=1127; Antisense; GGATTAGGTACTTCACTTTTCCAAT
>probe:Drosophila_2:1640346_at:114:697; Interrogation_Position=584; Antisense; TTTCATTGATTCCACGTACTACTCG
>probe:Drosophila_2:1640346_at:161:667; Interrogation_Position=603; Antisense; TACTCGGATGCCTGTCTTCTGCATA
>probe:Drosophila_2:1640346_at:301:619; Interrogation_Position=622; Antisense; TGCATACGCCTTCGCAAATTGCATT
>probe:Drosophila_2:1640346_at:445:629; Interrogation_Position=658; Antisense; TCCACGCGGCCAGCAGAGAGCAAGA
>probe:Drosophila_2:1640346_at:427:341; Interrogation_Position=694; Antisense; GCTATGTGACGGATCTTCTGTTTGT
>probe:Drosophila_2:1640346_at:168:109; Interrogation_Position=730; Antisense; AGAAGCTACCCGGACTCATAGATGC
>probe:Drosophila_2:1640346_at:202:377; Interrogation_Position=779; Antisense; GAAGCAATATCAGCAGCCCGATCGG
>probe:Drosophila_2:1640346_at:483:383; Interrogation_Position=870; Antisense; GAACTCTATAAGGAGCGCCTACGCC
>probe:Drosophila_2:1640346_at:286:135; Interrogation_Position=890; Antisense; ACGCCGATTGTACACCGATGAGGAT
>probe:Drosophila_2:1640346_at:414:607; Interrogation_Position=908; Antisense; TGAGGATGACATGCCCGCCGAAGAT
>probe:Drosophila_2:1640346_at:711:49; Interrogation_Position=931; Antisense; ATGCCTCATTCCACATTGCAGATGT
>probe:Drosophila_2:1640346_at:141:513; Interrogation_Position=954; Antisense; GTGAGCTCGGACACATCTGCTATGA

Paste this into a BLAST search page for me
ATGTGATGATCTACTACTGCGTGGAGGATTAGGTACTTCACTTTTCCAATTTTCATTGATTCCACGTACTACTCGTACTCGGATGCCTGTCTTCTGCATATGCATACGCCTTCGCAAATTGCATTTCCACGCGGCCAGCAGAGAGCAAGAGCTATGTGACGGATCTTCTGTTTGTAGAAGCTACCCGGACTCATAGATGCGAAGCAATATCAGCAGCCCGATCGGGAACTCTATAAGGAGCGCCTACGCCACGCCGATTGTACACCGATGAGGATTGAGGATGACATGCCCGCCGAAGATATGCCTCATTCCACATTGCAGATGTGTGAGCTCGGACACATCTGCTATGA

Full Affymetrix probeset data:

Annotations for 1640346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720