FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640347_at:

>probe:Drosophila_2:1640347_at:163:39; Interrogation_Position=317; Antisense; ATCTCTTGGAACTGGACATGGGCTT
>probe:Drosophila_2:1640347_at:257:173; Interrogation_Position=366; Antisense; AAAGCATATGGCCTTGTTCGTCTAT
>probe:Drosophila_2:1640347_at:636:717; Interrogation_Position=396; Antisense; TTCGCCGACTCGCAGTATAAGGATC
>probe:Drosophila_2:1640347_at:166:453; Interrogation_Position=417; Antisense; GATCTATCCCCATGGCAACATTTAT
>probe:Drosophila_2:1640347_at:609:181; Interrogation_Position=458; Antisense; AAAACAGCGCCCGATATGGTCTAGC
>probe:Drosophila_2:1640347_at:264:479; Interrogation_Position=524; Antisense; GTTTGCGACGGCTGAAGACCAATGC
>probe:Drosophila_2:1640347_at:78:367; Interrogation_Position=582; Antisense; GAATCTAAGACAGTTCCACCTGGAA
>probe:Drosophila_2:1640347_at:27:611; Interrogation_Position=617; Antisense; TGACCCGTTATGACACCTCGAAGTA
>probe:Drosophila_2:1640347_at:719:373; Interrogation_Position=636; Antisense; GAAGTATCCGTTCCTGGTGTACAAG
>probe:Drosophila_2:1640347_at:691:195; Interrogation_Position=672; Antisense; AACGGTCGAGATAGCTATCTTCCCC
>probe:Drosophila_2:1640347_at:635:139; Interrogation_Position=697; Antisense; ACGGGCTACGTAATCGTGCTGTTTG
>probe:Drosophila_2:1640347_at:178:509; Interrogation_Position=712; Antisense; GTGCTGTTTGCTACCACTATGGAAA
>probe:Drosophila_2:1640347_at:478:625; Interrogation_Position=764; Antisense; TGCCCACATTGTACCGCTTAAAGGA
>probe:Drosophila_2:1640347_at:488:351; Interrogation_Position=821; Antisense; GCAGCGGTGATATCGACTACAAACT

Paste this into a BLAST search page for me
ATCTCTTGGAACTGGACATGGGCTTAAAGCATATGGCCTTGTTCGTCTATTTCGCCGACTCGCAGTATAAGGATCGATCTATCCCCATGGCAACATTTATAAAACAGCGCCCGATATGGTCTAGCGTTTGCGACGGCTGAAGACCAATGCGAATCTAAGACAGTTCCACCTGGAATGACCCGTTATGACACCTCGAAGTAGAAGTATCCGTTCCTGGTGTACAAGAACGGTCGAGATAGCTATCTTCCCCACGGGCTACGTAATCGTGCTGTTTGGTGCTGTTTGCTACCACTATGGAAATGCCCACATTGTACCGCTTAAAGGAGCAGCGGTGATATCGACTACAAACT

Full Affymetrix probeset data:

Annotations for 1640347_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720