FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640348_at:

>probe:Drosophila_2:1640348_at:629:395; Interrogation_Position=1009; Antisense; GAAATCACAGAGTTGCGCCAGGAGA
>probe:Drosophila_2:1640348_at:628:165; Interrogation_Position=1041; Antisense; AAATCGCAACGGTGTCTTCGGTGAT
>probe:Drosophila_2:1640348_at:571:555; Interrogation_Position=1087; Antisense; GGACGCCTCCACGACCATGTGATTG
>probe:Drosophila_2:1640348_at:111:595; Interrogation_Position=1104; Antisense; TGTGATTGCGCCCTTTCAAGGCAAC
>probe:Drosophila_2:1640348_at:138:545; Interrogation_Position=1136; Antisense; GGATAAAACTTCGACGCTATTCCTT
>probe:Drosophila_2:1640348_at:312:411; Interrogation_Position=1148; Antisense; GACGCTATTCCTTTAACGTGATATA
>probe:Drosophila_2:1640348_at:195:21; Interrogation_Position=1172; Antisense; ATTTGTTTGCTTTGTATCTGCTGCC
>probe:Drosophila_2:1640348_at:177:621; Interrogation_Position=1190; Antisense; TGCTGCCTGGAATGTCTCTCAAATA
>probe:Drosophila_2:1640348_at:701:395; Interrogation_Position=691; Antisense; GACAAAACCAAACGGCTGCTCTTCA
>probe:Drosophila_2:1640348_at:587:337; Interrogation_Position=708; Antisense; GCTCTTCAGCGCCTACGTGGAACAA
>probe:Drosophila_2:1640348_at:403:669; Interrogation_Position=721; Antisense; TACGTGGAACAATCTAGCCTGCAAA
>probe:Drosophila_2:1640348_at:80:99; Interrogation_Position=832; Antisense; AGAGATAACAAGTACCGCCAGGTGC
>probe:Drosophila_2:1640348_at:597:229; Interrogation_Position=860; Antisense; AATGGTACCAGCGTGTACTGCACAA
>probe:Drosophila_2:1640348_at:381:435; Interrogation_Position=889; Antisense; GAGGTGTGCATTTACAACCTGGGAA

Paste this into a BLAST search page for me
GAAATCACAGAGTTGCGCCAGGAGAAAATCGCAACGGTGTCTTCGGTGATGGACGCCTCCACGACCATGTGATTGTGTGATTGCGCCCTTTCAAGGCAACGGATAAAACTTCGACGCTATTCCTTGACGCTATTCCTTTAACGTGATATAATTTGTTTGCTTTGTATCTGCTGCCTGCTGCCTGGAATGTCTCTCAAATAGACAAAACCAAACGGCTGCTCTTCAGCTCTTCAGCGCCTACGTGGAACAATACGTGGAACAATCTAGCCTGCAAAAGAGATAACAAGTACCGCCAGGTGCAATGGTACCAGCGTGTACTGCACAAGAGGTGTGCATTTACAACCTGGGAA

Full Affymetrix probeset data:

Annotations for 1640348_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720