FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640349_at:

>probe:Drosophila_2:1640349_at:63:481; Interrogation_Position=233; Antisense; GTTTGTTCTCGAAGATCTGTTCAAG
>probe:Drosophila_2:1640349_at:42:21; Interrogation_Position=265; Antisense; ATATTGTGATGGATCCCTTGGCGGA
>probe:Drosophila_2:1640349_at:42:563; Interrogation_Position=287; Antisense; GGAAGTGTACTCCTTGCCATTCTTG
>probe:Drosophila_2:1640349_at:692:95; Interrogation_Position=319; Antisense; AGATTCTGGAGCATCCCGAACTGGT
>probe:Drosophila_2:1640349_at:79:319; Interrogation_Position=351; Antisense; GCCGATGCTCCTGACAATAGTCTCA
>probe:Drosophila_2:1640349_at:502:247; Interrogation_Position=365; Antisense; CAATAGTCTCATGGGCTTCATTCTG
>probe:Drosophila_2:1640349_at:272:565; Interrogation_Position=445; Antisense; GGAATCATGGACACATCTCTGCTCT
>probe:Drosophila_2:1640349_at:340:581; Interrogation_Position=469; Antisense; TGGCCGTAGCTCAGGATTATCGTAA
>probe:Drosophila_2:1640349_at:174:695; Interrogation_Position=485; Antisense; TTATCGTAAACTGGGCTTGGGCACT
>probe:Drosophila_2:1640349_at:6:259; Interrogation_Position=506; Antisense; CACTCGGCTCTTAACAACCGTTAGG
>probe:Drosophila_2:1640349_at:526:273; Interrogation_Position=596; Antisense; CATTGGGCTTTACGAGTCCTTGGGA
>probe:Drosophila_2:1640349_at:716:541; Interrogation_Position=637; Antisense; GGATACCTAAGTTTTATGCCGACGA
>probe:Drosophila_2:1640349_at:192:683; Interrogation_Position=651; Antisense; TATGCCGACGACCATGGATACGAAA
>probe:Drosophila_2:1640349_at:348:57; Interrogation_Position=675; Antisense; ATGAGACTACCTTTGTCCAGCGATG

Paste this into a BLAST search page for me
GTTTGTTCTCGAAGATCTGTTCAAGATATTGTGATGGATCCCTTGGCGGAGGAAGTGTACTCCTTGCCATTCTTGAGATTCTGGAGCATCCCGAACTGGTGCCGATGCTCCTGACAATAGTCTCACAATAGTCTCATGGGCTTCATTCTGGGAATCATGGACACATCTCTGCTCTTGGCCGTAGCTCAGGATTATCGTAATTATCGTAAACTGGGCTTGGGCACTCACTCGGCTCTTAACAACCGTTAGGCATTGGGCTTTACGAGTCCTTGGGAGGATACCTAAGTTTTATGCCGACGATATGCCGACGACCATGGATACGAAAATGAGACTACCTTTGTCCAGCGATG

Full Affymetrix probeset data:

Annotations for 1640349_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720