Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640351_s_at:

>probe:Drosophila_2:1640351_s_at:450:155; Interrogation_Position=1061; Antisense; ACAGCTTCCGCTTGATGATATTCCG
>probe:Drosophila_2:1640351_s_at:29:491; Interrogation_Position=1089; Antisense; GTACATAATCGTTGGTTTCCACCGA
>probe:Drosophila_2:1640351_s_at:475:595; Interrogation_Position=607; Antisense; TGTGGTCAATGCCAATCTGCCCGTG
>probe:Drosophila_2:1640351_s_at:658:175; Interrogation_Position=641; Antisense; AAACGCGGTATATTCGGCCACAGTA
>probe:Drosophila_2:1640351_s_at:535:605; Interrogation_Position=684; Antisense; TGATCTGCGCGCTTAAGAATCCCGG
>probe:Drosophila_2:1640351_s_at:508:105; Interrogation_Position=699; Antisense; AGAATCCCGGGCTGTACCAGTCGGT
>probe:Drosophila_2:1640351_s_at:480:683; Interrogation_Position=788; Antisense; TATCTGGGCTCCAATCCGGATGACT
>probe:Drosophila_2:1640351_s_at:6:55; Interrogation_Position=807; Antisense; ATGACTGGGCCCTGTGGGATGCCAC
>probe:Drosophila_2:1640351_s_at:392:135; Interrogation_Position=830; Antisense; ACGCATCTGGTGTCGCAGTACGAGA
>probe:Drosophila_2:1640351_s_at:331:419; Interrogation_Position=866; Antisense; GAGCTCTTCATCGACCAAGGTGCAG
>probe:Drosophila_2:1640351_s_at:282:223; Interrogation_Position=882; Antisense; AAGGTGCAGCAGACAACTTCCTGGC
>probe:Drosophila_2:1640351_s_at:594:361; Interrogation_Position=951; Antisense; GCAATGATCACATCCAGACCATCTT
>probe:Drosophila_2:1640351_s_at:546:103; Interrogation_Position=966; Antisense; AGACCATCTTCAAGCAGCGCGAGGG
>probe:Drosophila_2:1640351_s_at:701:527; Interrogation_Position=988; Antisense; GGGATACGATCACAGCTACTTCTAC

Paste this into a BLAST search page for me
ACAGCTTCCGCTTGATGATATTCCGGTACATAATCGTTGGTTTCCACCGATGTGGTCAATGCCAATCTGCCCGTGAAACGCGGTATATTCGGCCACAGTATGATCTGCGCGCTTAAGAATCCCGGAGAATCCCGGGCTGTACCAGTCGGTTATCTGGGCTCCAATCCGGATGACTATGACTGGGCCCTGTGGGATGCCACACGCATCTGGTGTCGCAGTACGAGAGAGCTCTTCATCGACCAAGGTGCAGAAGGTGCAGCAGACAACTTCCTGGCGCAATGATCACATCCAGACCATCTTAGACCATCTTCAAGCAGCGCGAGGGGGGATACGATCACAGCTACTTCTAC

Full Affymetrix probeset data:

Annotations for 1640351_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime