FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640354_at:

>probe:Drosophila_2:1640354_at:130:91; Interrogation_Position=140; Antisense; AGTACCAGTACCAGAATCACAGCCT
>probe:Drosophila_2:1640354_at:115:239; Interrogation_Position=154; Antisense; AATCACAGCCTGAATCCGAGTCCGA
>probe:Drosophila_2:1640354_at:549:239; Interrogation_Position=196; Antisense; AATCAAGCATCAATGTCCTCGTCGC
>probe:Drosophila_2:1640354_at:313:597; Interrogation_Position=209; Antisense; TGTCCTCGTCGCTGAGCAGCCTGAA
>probe:Drosophila_2:1640354_at:172:615; Interrogation_Position=230; Antisense; TGAATCCCAGCAGTTCGCAGTTGGA
>probe:Drosophila_2:1640354_at:75:267; Interrogation_Position=240; Antisense; CAGTTCGCAGTTGGAGGTGACTTCT
>probe:Drosophila_2:1640354_at:14:81; Interrogation_Position=254; Antisense; AGGTGACTTCTGCTGGCGACAATCT
>probe:Drosophila_2:1640354_at:221:337; Interrogation_Position=284; Antisense; GCTCCGTGAGCTTTCTCAGCGAGGA
>probe:Drosophila_2:1640354_at:666:321; Interrogation_Position=30; Antisense; GCGCCAGAATCGCTTCACACAGTTA
>probe:Drosophila_2:1640354_at:275:77; Interrogation_Position=335; Antisense; AGGAGTTTCATGATCCGCACAGGTA
>probe:Drosophila_2:1640354_at:518:341; Interrogation_Position=41; Antisense; GCTTCACACAGTTAATGGACCGCCT
>probe:Drosophila_2:1640354_at:50:433; Interrogation_Position=74; Antisense; GAGGGCTCAGTTCAAGCTCGGCCAA
>probe:Drosophila_2:1640354_at:263:711; Interrogation_Position=84; Antisense; TTCAAGCTCGGCCAAACTGGGCACA
>probe:Drosophila_2:1640354_at:573:177; Interrogation_Position=97; Antisense; AAACTGGGCACACCGGTGGCGCCAC

Paste this into a BLAST search page for me
AGTACCAGTACCAGAATCACAGCCTAATCACAGCCTGAATCCGAGTCCGAAATCAAGCATCAATGTCCTCGTCGCTGTCCTCGTCGCTGAGCAGCCTGAATGAATCCCAGCAGTTCGCAGTTGGACAGTTCGCAGTTGGAGGTGACTTCTAGGTGACTTCTGCTGGCGACAATCTGCTCCGTGAGCTTTCTCAGCGAGGAGCGCCAGAATCGCTTCACACAGTTAAGGAGTTTCATGATCCGCACAGGTAGCTTCACACAGTTAATGGACCGCCTGAGGGCTCAGTTCAAGCTCGGCCAATTCAAGCTCGGCCAAACTGGGCACAAAACTGGGCACACCGGTGGCGCCAC

Full Affymetrix probeset data:

Annotations for 1640354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720