FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640355_at:

>probe:Drosophila_2:1640355_at:144:659; Interrogation_Position=414; Antisense; TAAGCCCATTGTTTACGACGACCTG
>probe:Drosophila_2:1640355_at:602:409; Interrogation_Position=430; Antisense; GACGACCTGACTCAACCTATTAAAC
>probe:Drosophila_2:1640355_at:278:581; Interrogation_Position=455; Antisense; TGGCCAGCAAGGGATCACTGCCGAA
>probe:Drosophila_2:1640355_at:655:537; Interrogation_Position=533; Antisense; GGTACTCCACCCAGCTGCAGAAAAT
>probe:Drosophila_2:1640355_at:362:667; Interrogation_Position=568; Antisense; TACATCGATCACGACAACTGCCAGT
>probe:Drosophila_2:1640355_at:698:159; Interrogation_Position=581; Antisense; ACAACTGCCAGTCTCGAGTGCGAAA
>probe:Drosophila_2:1640355_at:81:197; Interrogation_Position=610; Antisense; AACTGGCTGAGCGAAGGACACGTGT
>probe:Drosophila_2:1640355_at:17:83; Interrogation_Position=656; Antisense; AGGGATCTTGCCATGGAGACTCCGG
>probe:Drosophila_2:1640355_at:621:623; Interrogation_Position=741; Antisense; TGCCATTGGCTATCCGGATGTGTTC
>probe:Drosophila_2:1640355_at:120:63; Interrogation_Position=758; Antisense; ATGTGTTCGGTTCGGTCGCCTACTA
>probe:Drosophila_2:1640355_at:456:97; Interrogation_Position=800; Antisense; AGATGATGACAGACGCTGGTACCGC
>probe:Drosophila_2:1640355_at:10:589; Interrogation_Position=816; Antisense; TGGTACCGCGTGCTAAAGGTCCAAA
>probe:Drosophila_2:1640355_at:343:119; Interrogation_Position=885; Antisense; AGCTGCCATCTAATGGCTTCTGCAA
>probe:Drosophila_2:1640355_at:78:387; Interrogation_Position=984; Antisense; GAACAATTGCGCTTCAGTTTAAATA

Paste this into a BLAST search page for me
TAAGCCCATTGTTTACGACGACCTGGACGACCTGACTCAACCTATTAAACTGGCCAGCAAGGGATCACTGCCGAAGGTACTCCACCCAGCTGCAGAAAATTACATCGATCACGACAACTGCCAGTACAACTGCCAGTCTCGAGTGCGAAAAACTGGCTGAGCGAAGGACACGTGTAGGGATCTTGCCATGGAGACTCCGGTGCCATTGGCTATCCGGATGTGTTCATGTGTTCGGTTCGGTCGCCTACTAAGATGATGACAGACGCTGGTACCGCTGGTACCGCGTGCTAAAGGTCCAAAAGCTGCCATCTAATGGCTTCTGCAAGAACAATTGCGCTTCAGTTTAAATA

Full Affymetrix probeset data:

Annotations for 1640355_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720