Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640356_a_at:

>probe:Drosophila_2:1640356_a_at:316:221; Interrogation_Position=398; Antisense; AAGTGACACACTTTGGACCCGAGCA
>probe:Drosophila_2:1640356_a_at:114:335; Interrogation_Position=455; Antisense; GCTGCGTCCAAATTTGGGCGGTACT
>probe:Drosophila_2:1640356_a_at:25:153; Interrogation_Position=508; Antisense; ACATGAATTTCAGGCCCGGAGGACC
>probe:Drosophila_2:1640356_a_at:156:35; Interrogation_Position=537; Antisense; ATCACCAGGTCGGAAGCGCGCGGAA
>probe:Drosophila_2:1640356_a_at:86:325; Interrogation_Position=592; Antisense; GCGAGATCCTGGTCATGGGCGTCAT
>probe:Drosophila_2:1640356_a_at:629:523; Interrogation_Position=608; Antisense; GGGCGTCATCCATTTGTGCAAGAAG
>probe:Drosophila_2:1640356_a_at:325:555; Interrogation_Position=650; Antisense; GGACCTCAAAGTAGCCTTGTATCTG
>probe:Drosophila_2:1640356_a_at:375:41; Interrogation_Position=670; Antisense; ATCTGGGCAGTCTGTTTGTGATCTC
>probe:Drosophila_2:1640356_a_at:533:449; Interrogation_Position=739; Antisense; GATCGGACAACCTGTTCAACCAGTA
>probe:Drosophila_2:1640356_a_at:567:313; Interrogation_Position=818; Antisense; GCTCTCGGCCTATACGATTACGTGT
>probe:Drosophila_2:1640356_a_at:207:595; Interrogation_Position=840; Antisense; TGTGGCGACCACAAACGGATGCTGC
>probe:Drosophila_2:1640356_a_at:607:275; Interrogation_Position=896; Antisense; CTTCTTCTGGTTCTTCTGGACCAAG
>probe:Drosophila_2:1640356_a_at:602:549; Interrogation_Position=913; Antisense; GGACCAAGCTGTTTAACGTCGTGGA
>probe:Drosophila_2:1640356_a_at:30:521; Interrogation_Position=933; Antisense; GTGGAGAACTCCTACGGACGCTGCA

Paste this into a BLAST search page for me
AAGTGACACACTTTGGACCCGAGCAGCTGCGTCCAAATTTGGGCGGTACTACATGAATTTCAGGCCCGGAGGACCATCACCAGGTCGGAAGCGCGCGGAAGCGAGATCCTGGTCATGGGCGTCATGGGCGTCATCCATTTGTGCAAGAAGGGACCTCAAAGTAGCCTTGTATCTGATCTGGGCAGTCTGTTTGTGATCTCGATCGGACAACCTGTTCAACCAGTAGCTCTCGGCCTATACGATTACGTGTTGTGGCGACCACAAACGGATGCTGCCTTCTTCTGGTTCTTCTGGACCAAGGGACCAAGCTGTTTAACGTCGTGGAGTGGAGAACTCCTACGGACGCTGCA

Full Affymetrix probeset data:

Annotations for 1640356_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime