FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640357_at:

>probe:Drosophila_2:1640357_at:729:273; Interrogation_Position=331; Antisense; CATTGGGCAGATTGATCCGCGGGCA
>probe:Drosophila_2:1640357_at:257:215; Interrogation_Position=369; Antisense; AAGATCCCAAGGACCTCGAGCTGAA
>probe:Drosophila_2:1640357_at:256:375; Interrogation_Position=394; Antisense; GAAGATGTTCCAAACGCTGTTCTCT
>probe:Drosophila_2:1640357_at:705:199; Interrogation_Position=406; Antisense; AACGCTGTTCTCTTCGAACGACAAG
>probe:Drosophila_2:1640357_at:13:297; Interrogation_Position=420; Antisense; CGAACGACAAGACTGCCTCCGAGGA
>probe:Drosophila_2:1640357_at:329:233; Interrogation_Position=479; Antisense; AATGCTTTAAAGACATCCGCCCGTT
>probe:Drosophila_2:1640357_at:573:547; Interrogation_Position=552; Antisense; GGATGTCTCTCTTGCCAATTGAATC
>probe:Drosophila_2:1640357_at:150:559; Interrogation_Position=585; Antisense; GGACACTTACTAACGAGGCATCTCT
>probe:Drosophila_2:1640357_at:683:569; Interrogation_Position=601; Antisense; GGCATCTCTAAATTTTTCCTCACTT
>probe:Drosophila_2:1640357_at:633:647; Interrogation_Position=620; Antisense; TCACTTATACCGCATGCCTTGGAAA
>probe:Drosophila_2:1640357_at:233:253; Interrogation_Position=687; Antisense; CAAGCTTTCTGAAGGGTGTGGCCAA
>probe:Drosophila_2:1640357_at:21:103; Interrogation_Position=740; Antisense; AGAGACTGGGATTCCAAGCCTGCAC
>probe:Drosophila_2:1640357_at:155:205; Interrogation_Position=755; Antisense; AAGCCTGCACAAGAAATCCTTCCGA
>probe:Drosophila_2:1640357_at:140:319; Interrogation_Position=782; Antisense; GCCGCGGGCGCATAGTTTTCAAATT

Paste this into a BLAST search page for me
CATTGGGCAGATTGATCCGCGGGCAAAGATCCCAAGGACCTCGAGCTGAAGAAGATGTTCCAAACGCTGTTCTCTAACGCTGTTCTCTTCGAACGACAAGCGAACGACAAGACTGCCTCCGAGGAAATGCTTTAAAGACATCCGCCCGTTGGATGTCTCTCTTGCCAATTGAATCGGACACTTACTAACGAGGCATCTCTGGCATCTCTAAATTTTTCCTCACTTTCACTTATACCGCATGCCTTGGAAACAAGCTTTCTGAAGGGTGTGGCCAAAGAGACTGGGATTCCAAGCCTGCACAAGCCTGCACAAGAAATCCTTCCGAGCCGCGGGCGCATAGTTTTCAAATT

Full Affymetrix probeset data:

Annotations for 1640357_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720