FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640358_at:

>probe:Drosophila_2:1640358_at:97:157; Interrogation_Position=426; Antisense; ACACCAGTGCCTACCAGGAGTTCAA
>probe:Drosophila_2:1640358_at:237:207; Interrogation_Position=476; Antisense; AAGCTCGTTCAGCTGGGATTTCCTA
>probe:Drosophila_2:1640358_at:334:333; Interrogation_Position=487; Antisense; GCTGGGATTTCCTAGTTTTACATTG
>probe:Drosophila_2:1640358_at:611:145; Interrogation_Position=506; Antisense; ACATTGGAGGACTTTCACGAAACGT
>probe:Drosophila_2:1640358_at:49:67; Interrogation_Position=533; Antisense; ATGGAAGTCATCCAGCGCGTTAGCC
>probe:Drosophila_2:1640358_at:712:327; Interrogation_Position=549; Antisense; GCGTTAGCCCCGACAATGCAGGAGG
>probe:Drosophila_2:1640358_at:677:539; Interrogation_Position=620; Antisense; GGTTACTCAGACTACGTGGTGGTTT
>probe:Drosophila_2:1640358_at:423:655; Interrogation_Position=644; Antisense; TACCTACGTTTGATCACCTCGGGAA
>probe:Drosophila_2:1640358_at:417:163; Interrogation_Position=697; Antisense; AAATTTCATCGAAGGCGACCTCACC
>probe:Drosophila_2:1640358_at:420:633; Interrogation_Position=732; Antisense; TCCGCCATCTGGAAGTGGAGCCGAT
>probe:Drosophila_2:1640358_at:563:93; Interrogation_Position=814; Antisense; AGTTCGTGTCGAGTACTTGGACCGT
>probe:Drosophila_2:1640358_at:689:295; Interrogation_Position=883; Antisense; CGAGCCCCGAATTTACCTGATATAT
>probe:Drosophila_2:1640358_at:272:605; Interrogation_Position=900; Antisense; TGATATATCGACCAGGCCACTACGA
>probe:Drosophila_2:1640358_at:275:363; Interrogation_Position=942; Antisense; GAATTGCTCTCAGTAGTTTCTAGAT

Paste this into a BLAST search page for me
ACACCAGTGCCTACCAGGAGTTCAAAAGCTCGTTCAGCTGGGATTTCCTAGCTGGGATTTCCTAGTTTTACATTGACATTGGAGGACTTTCACGAAACGTATGGAAGTCATCCAGCGCGTTAGCCGCGTTAGCCCCGACAATGCAGGAGGGGTTACTCAGACTACGTGGTGGTTTTACCTACGTTTGATCACCTCGGGAAAAATTTCATCGAAGGCGACCTCACCTCCGCCATCTGGAAGTGGAGCCGATAGTTCGTGTCGAGTACTTGGACCGTCGAGCCCCGAATTTACCTGATATATTGATATATCGACCAGGCCACTACGAGAATTGCTCTCAGTAGTTTCTAGAT

Full Affymetrix probeset data:

Annotations for 1640358_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720