Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640359_s_at:

>probe:Drosophila_2:1640359_s_at:567:681; Interrogation_Position=500; Antisense; TATGCAGCTATTTCGTGCAGCTTAT
>probe:Drosophila_2:1640359_s_at:466:681; Interrogation_Position=522; Antisense; TATGTGCAATATCCTGCGGGACTCG
>probe:Drosophila_2:1640359_s_at:521:329; Interrogation_Position=537; Antisense; GCGGGACTCGCAAATAACTACCATC
>probe:Drosophila_2:1640359_s_at:439:59; Interrogation_Position=565; Antisense; ATGTTGCTATCGCACTTGTTTGGCA
>probe:Drosophila_2:1640359_s_at:553:703; Interrogation_Position=580; Antisense; TTGTTTGGCATGTGAACCGCGGGTC
>probe:Drosophila_2:1640359_s_at:88:381; Interrogation_Position=593; Antisense; GAACCGCGGGTCGTGTAAACAAGCA
>probe:Drosophila_2:1640359_s_at:639:209; Interrogation_Position=624; Antisense; AAGCACTCCACGATTCGACTATTAG
>probe:Drosophila_2:1640359_s_at:461:73; Interrogation_Position=734; Antisense; AGGAATCCACTAAAGCGACCGCATC
>probe:Drosophila_2:1640359_s_at:592:411; Interrogation_Position=750; Antisense; GACCGCATCACCATCGACAAAGGGA
>probe:Drosophila_2:1640359_s_at:459:703; Interrogation_Position=779; Antisense; TTTTGGTCCAAAACACGGCCATCAT
>probe:Drosophila_2:1640359_s_at:240:83; Interrogation_Position=811; Antisense; AGTGGCCACCGGTTGCCAGGAACAA
>probe:Drosophila_2:1640359_s_at:727:71; Interrogation_Position=828; Antisense; AGGAACAACCGCAGCTTCAACATCG
>probe:Drosophila_2:1640359_s_at:331:359; Interrogation_Position=881; Antisense; GCAACAGCTCTGTAATTCATGGTTA
>probe:Drosophila_2:1640359_s_at:518:145; Interrogation_Position=908; Antisense; ACTACCGAACGAACTGCTGATATTG

Paste this into a BLAST search page for me
TATGCAGCTATTTCGTGCAGCTTATTATGTGCAATATCCTGCGGGACTCGGCGGGACTCGCAAATAACTACCATCATGTTGCTATCGCACTTGTTTGGCATTGTTTGGCATGTGAACCGCGGGTCGAACCGCGGGTCGTGTAAACAAGCAAAGCACTCCACGATTCGACTATTAGAGGAATCCACTAAAGCGACCGCATCGACCGCATCACCATCGACAAAGGGATTTTGGTCCAAAACACGGCCATCATAGTGGCCACCGGTTGCCAGGAACAAAGGAACAACCGCAGCTTCAACATCGGCAACAGCTCTGTAATTCATGGTTAACTACCGAACGAACTGCTGATATTG

Full Affymetrix probeset data:

Annotations for 1640359_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime