Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640360_at:

>probe:Drosophila_2:1640360_at:690:643; Interrogation_Position=114; Antisense; TCTTTGTGTTCGGTCTGCTGGCTCT
>probe:Drosophila_2:1640360_at:722:101; Interrogation_Position=14; Antisense; AGAGCATCAGTTGAATTCAATCGAT
>probe:Drosophila_2:1640360_at:60:449; Interrogation_Position=164; Antisense; GATCCAGGAAATGTGGTAATCAACG
>probe:Drosophila_2:1640360_at:375:241; Interrogation_Position=198; Antisense; AATACTGCAATGTGCACGGTGGAAA
>probe:Drosophila_2:1640360_at:579:393; Interrogation_Position=243; Antisense; GAAAGTACTCGCCTTAATTTCGAAG
>probe:Drosophila_2:1640360_at:218:145; Interrogation_Position=249; Antisense; ACTCGCCTTAATTTCGAAGATGGGC
>probe:Drosophila_2:1640360_at:434:371; Interrogation_Position=264; Antisense; GAAGATGGGCCAAAACTTACCTCAA
>probe:Drosophila_2:1640360_at:561:271; Interrogation_Position=279; Antisense; CTTACCTCAAATCCAAAGCACCATA
>probe:Drosophila_2:1640360_at:496:111; Interrogation_Position=295; Antisense; AGCACCATATTTATACTCTCACTCT
>probe:Drosophila_2:1640360_at:160:651; Interrogation_Position=30; Antisense; TCAATCGATTGCTTGTGCATTTAGC
>probe:Drosophila_2:1640360_at:18:29; Interrogation_Position=307; Antisense; ATACTCTCACTCTTGTACTAAAATG
>probe:Drosophila_2:1640360_at:406:485; Interrogation_Position=339; Antisense; GTAGTAAAAAATACATCGCCAATTA
>probe:Drosophila_2:1640360_at:533:345; Interrogation_Position=46; Antisense; GCATTTAGCAAATCAAAGCCACAAC
>probe:Drosophila_2:1640360_at:510:203; Interrogation_Position=61; Antisense; AAGCCACAACAACCAAACCAGAATC

Paste this into a BLAST search page for me
TCTTTGTGTTCGGTCTGCTGGCTCTAGAGCATCAGTTGAATTCAATCGATGATCCAGGAAATGTGGTAATCAACGAATACTGCAATGTGCACGGTGGAAAGAAAGTACTCGCCTTAATTTCGAAGACTCGCCTTAATTTCGAAGATGGGCGAAGATGGGCCAAAACTTACCTCAACTTACCTCAAATCCAAAGCACCATAAGCACCATATTTATACTCTCACTCTTCAATCGATTGCTTGTGCATTTAGCATACTCTCACTCTTGTACTAAAATGGTAGTAAAAAATACATCGCCAATTAGCATTTAGCAAATCAAAGCCACAACAAGCCACAACAACCAAACCAGAATC

Full Affymetrix probeset data:

Annotations for 1640360_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime