FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640361_at:

>probe:Drosophila_2:1640361_at:7:707; Interrogation_Position=1568; Antisense; TTCAGGGCCCGCTAGGAAGTGCGAG
>probe:Drosophila_2:1640361_at:407:269; Interrogation_Position=1689; Antisense; CATCCAGCGTATGTTTAGCAAACTA
>probe:Drosophila_2:1640361_at:482:483; Interrogation_Position=1697; Antisense; GTATGTTTAGCAAACTAGACTAGTT
>probe:Drosophila_2:1640361_at:583:361; Interrogation_Position=1714; Antisense; GACTAGTTTAAGTGAATTCTGCCAT
>probe:Drosophila_2:1640361_at:531:657; Interrogation_Position=1722; Antisense; TAAGTGAATTCTGCCATGTCTGTCC
>probe:Drosophila_2:1640361_at:4:245; Interrogation_Position=1728; Antisense; AATTCTGCCATGTCTGTCCACTTTA
>probe:Drosophila_2:1640361_at:616:627; Interrogation_Position=1733; Antisense; TGCCATGTCTGTCCACTTTAGAATT
>probe:Drosophila_2:1640361_at:677:499; Interrogation_Position=1739; Antisense; GTCTGTCCACTTTAGAATTTTGTGT
>probe:Drosophila_2:1640361_at:63:163; Interrogation_Position=1774; Antisense; AAATTTTTGTCTTATTATCATAGAA
>probe:Drosophila_2:1640361_at:171:37; Interrogation_Position=1790; Antisense; ATCATAGAAATTCAGCAGTCCCACT
>probe:Drosophila_2:1640361_at:143:107; Interrogation_Position=1795; Antisense; AGAAATTCAGCAGTCCCACTATAGA
>probe:Drosophila_2:1640361_at:722:649; Interrogation_Position=1801; Antisense; TCAGCAGTCCCACTATAGACACAAC
>probe:Drosophila_2:1640361_at:545:349; Interrogation_Position=1804; Antisense; GCAGTCCCACTATAGACACAACAAA
>probe:Drosophila_2:1640361_at:305:107; Interrogation_Position=1840; Antisense; AGAAACTGATTTTACAATTGCTTGT

Paste this into a BLAST search page for me
TTCAGGGCCCGCTAGGAAGTGCGAGCATCCAGCGTATGTTTAGCAAACTAGTATGTTTAGCAAACTAGACTAGTTGACTAGTTTAAGTGAATTCTGCCATTAAGTGAATTCTGCCATGTCTGTCCAATTCTGCCATGTCTGTCCACTTTATGCCATGTCTGTCCACTTTAGAATTGTCTGTCCACTTTAGAATTTTGTGTAAATTTTTGTCTTATTATCATAGAAATCATAGAAATTCAGCAGTCCCACTAGAAATTCAGCAGTCCCACTATAGATCAGCAGTCCCACTATAGACACAACGCAGTCCCACTATAGACACAACAAAAGAAACTGATTTTACAATTGCTTGT

Full Affymetrix probeset data:

Annotations for 1640361_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720