FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640362_at:

>probe:Drosophila_2:1640362_at:112:305; Interrogation_Position=1027; Antisense; CCGTGCAGGTCAGCCTGGAGCAGAA
>probe:Drosophila_2:1640362_at:673:481; Interrogation_Position=1078; Antisense; GTAGCCCTTAAGCATTGGTTCCGAA
>probe:Drosophila_2:1640362_at:255:541; Interrogation_Position=1094; Antisense; GGTTCCGAACACAAGCAGATAATTT
>probe:Drosophila_2:1640362_at:722:443; Interrogation_Position=1111; Antisense; GATAATTTTCGAGCTCAGGGCCGGA
>probe:Drosophila_2:1640362_at:271:117; Interrogation_Position=1122; Antisense; AGCTCAGGGCCGGAATTTCATTTAT
>probe:Drosophila_2:1640362_at:298:461; Interrogation_Position=1149; Antisense; GATTTATGTGATGTGTGCTGCTGGT
>probe:Drosophila_2:1640362_at:114:621; Interrogation_Position=1164; Antisense; TGCTGCTGGTTTAGGTGGTTTCTTA
>probe:Drosophila_2:1640362_at:506:477; Interrogation_Position=1181; Antisense; GTTTCTTAGCAACTGACCGTGTGTT
>probe:Drosophila_2:1640362_at:32:437; Interrogation_Position=1222; Antisense; GAGGCTTAGTTGTTCCTACATTTTT
>probe:Drosophila_2:1640362_at:68:139; Interrogation_Position=715; Antisense; ACGTGTACGAGAGCAAGCGGCAGCA
>probe:Drosophila_2:1640362_at:239:323; Interrogation_Position=800; Antisense; GCCCAACTTTAAGGCCATGCACAAG
>probe:Drosophila_2:1640362_at:53:383; Interrogation_Position=830; Antisense; GAACGAGCTGGCAGTCATCCACAAA
>probe:Drosophila_2:1640362_at:302:425; Interrogation_Position=876; Antisense; GAGACGCTCAAGCACAGCCAGTCGA
>probe:Drosophila_2:1640362_at:264:69; Interrogation_Position=937; Antisense; AGGCGCGACTGCATCCGGCTGGTAC

Paste this into a BLAST search page for me
CCGTGCAGGTCAGCCTGGAGCAGAAGTAGCCCTTAAGCATTGGTTCCGAAGGTTCCGAACACAAGCAGATAATTTGATAATTTTCGAGCTCAGGGCCGGAAGCTCAGGGCCGGAATTTCATTTATGATTTATGTGATGTGTGCTGCTGGTTGCTGCTGGTTTAGGTGGTTTCTTAGTTTCTTAGCAACTGACCGTGTGTTGAGGCTTAGTTGTTCCTACATTTTTACGTGTACGAGAGCAAGCGGCAGCAGCCCAACTTTAAGGCCATGCACAAGGAACGAGCTGGCAGTCATCCACAAAGAGACGCTCAAGCACAGCCAGTCGAAGGCGCGACTGCATCCGGCTGGTAC

Full Affymetrix probeset data:

Annotations for 1640362_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720