Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640364_at:

>probe:Drosophila_2:1640364_at:532:447; Interrogation_Position=1597; Antisense; GATCCGACCGATCGTCAATTGAACT
>probe:Drosophila_2:1640364_at:133:723; Interrogation_Position=1615; Antisense; TTGAACTCTGAACATCTGGCCTAAT
>probe:Drosophila_2:1640364_at:529:13; Interrogation_Position=1668; Antisense; ATTAAAGTTCAAATCGTACACACGC
>probe:Drosophila_2:1640364_at:345:491; Interrogation_Position=1683; Antisense; GTACACACGCAATTGTTGTTATAGC
>probe:Drosophila_2:1640364_at:162:345; Interrogation_Position=1713; Antisense; GCTTGTCTATTGCTATCAGTTATTA
>probe:Drosophila_2:1640364_at:595:671; Interrogation_Position=1781; Antisense; TACGATCATTATTTTCTGTCAGTTG
>probe:Drosophila_2:1640364_at:22:391; Interrogation_Position=1831; Antisense; GAAACATGCCCGAAAAATTCTTTGT
>probe:Drosophila_2:1640364_at:472:185; Interrogation_Position=1844; Antisense; AAAATTCTTTGTTTCCCGCACATCG
>probe:Drosophila_2:1640364_at:338:271; Interrogation_Position=1864; Antisense; CATCGCCTAGGCTTGTTCAATTTGT
>probe:Drosophila_2:1640364_at:255:137; Interrogation_Position=1943; Antisense; ACGAAACATTTTGATCTAAGCTGAA
>probe:Drosophila_2:1640364_at:110:379; Interrogation_Position=2005; Antisense; GAACCTCTAAGTAGTGCAATTTTTA
>probe:Drosophila_2:1640364_at:104:173; Interrogation_Position=2029; Antisense; AAAGCAACAACCACAGTAACTAAGA
>probe:Drosophila_2:1640364_at:290:395; Interrogation_Position=2052; Antisense; GAAATTCCAGTCTTATTTATGCGAC
>probe:Drosophila_2:1640364_at:367:325; Interrogation_Position=2144; Antisense; GCGAATAATGTTTTTGCGTTGTATC

Paste this into a BLAST search page for me
GATCCGACCGATCGTCAATTGAACTTTGAACTCTGAACATCTGGCCTAATATTAAAGTTCAAATCGTACACACGCGTACACACGCAATTGTTGTTATAGCGCTTGTCTATTGCTATCAGTTATTATACGATCATTATTTTCTGTCAGTTGGAAACATGCCCGAAAAATTCTTTGTAAAATTCTTTGTTTCCCGCACATCGCATCGCCTAGGCTTGTTCAATTTGTACGAAACATTTTGATCTAAGCTGAAGAACCTCTAAGTAGTGCAATTTTTAAAAGCAACAACCACAGTAACTAAGAGAAATTCCAGTCTTATTTATGCGACGCGAATAATGTTTTTGCGTTGTATC

Full Affymetrix probeset data:

Annotations for 1640364_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime